SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_TrvaMG_comp12095_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_E3_ubiquitin-protein_ligase_MIB1_[Bombyx_mori]
Ontology
GO:0000151 C ubiquitin ligase complex
GO:0001568 P blood vessel development
GO:0001570 P vasculogenesis
GO:0001756 P somitogenesis
GO:0001885 P endothelial cell development
GO:0002064 P epithelial cell development
GO:0002090 P regulation of receptor internalization
GO:0003407 P neural retina development
GO:0003408 P optic cup formation involved in camera-type eye development
GO:0004842 F ubiquitin-protein transferase activity
GO:0005515 F protein binding
GO:0005737 C cytoplasm
GO:0005815 C microtubule organizing center
GO:0005856 C cytoskeleton
GO:0005886 C plasma membrane
GO:0007219 P Notch signaling pathway
GO:0007275 P multicellular organism development
GO:0007368 P determination of left/right symmetry
GO:0007417 P central nervous system development
GO:0007420 P brain development
GO:0007507 P heart development
GO:0008270 F zinc ion binding
GO:0008284 P positive regulation of cell population proliferation
GO:0008593 P regulation of Notch signaling pathway
GO:0009880 P embryonic pattern specification
GO:0010001 P glial cell differentiation
GO:0016020 C membrane
GO:0016567 P protein ubiquitination
GO:0016874 F ligase activity
GO:0021508 P floor plate formation
GO:0021510 P spinal cord development
GO:0021514 P ventral spinal cord interneuron differentiation
GO:0021519 P spinal cord association neuron specification
GO:0021520 P spinal cord motor neuron cell fate specification
GO:0021521 P ventral spinal cord interneuron specification
GO:0021536 P diencephalon development
GO:0021546 P rhombomere development
GO:0021654 P rhombomere boundary formation
GO:0021986 P habenula development
GO:0030097 P hemopoiesis
GO:0030139 C endocytic vesicle
GO:0030182 P neuron differentiation
GO:0030318 P melanocyte differentiation
GO:0030902 P hindbrain development
GO:0030903 P notochord development
GO:0031076 P embryonic camera-type eye development
GO:0031398 P positive regulation of protein ubiquitination
GO:0031410 C cytoplasmic vesicle
GO:0035315 P hair cell differentiation
GO:0039022 P pronephric duct development
GO:0042803 F protein homodimerization activity
GO:0043234 C protein-containing complex
GO:0045664 P regulation of neuron differentiation
GO:0045685 P regulation of glial cell differentiation
GO:0045747 P positive regulation of Notch signaling pathway
GO:0046872 F metal ion binding
GO:0048259 P regulation of receptor-mediated endocytosis
GO:0048471 C perinuclear region of cytoplasm
GO:0048514 P blood vessel morphogenesis
GO:0048546 P digestive tract morphogenesis
GO:0048663 P neuron fate commitment
GO:0048665 P neuron fate specification
GO:0048666 P neuron development
GO:0048699 P generation of neurons
GO:0048793 P pronephros development
GO:0048859 P formation of anatomical boundary
GO:0048892 P lateral line nerve development
GO:0048899 P anterior lateral line development
GO:0048916 P posterior lateral line development
GO:0051865 P protein autoubiquitination
GO:0060035 P notochord cell development
GO:0060113 P inner ear receptor cell differentiation
GO:0060218 P hematopoietic stem cell differentiation
GO:0061195 P taste bud formation
GO:0061551 P trigeminal ganglion development
GO:0070086 P ubiquitin-dependent endocytosis
GO:0071599 P otic vesicle development
Transcript
Level		FPKM:2.56 TPM:2.15
ORF Entry
Sequence
(Nucleotide)
TTGCCTACAAGTGTCACACATAGTTCCCTCATGTTTGACACCTGTAGGAGCACTGTCTAA
GATTCGGAGGTCATAGGCGCCTGAACATCGGTAGTTTGCAGCTGTTCCATTATCCCAAAC
GACTACCACTTCTTCTGGTGACTCAAAGTTTCTAACTGTTCCTAGGTGACCCTCTCCTCC
ATCCTGTTTACCCCACTTCCAGTCAGGACCTCTAATCACTCGAGCTCCCACCCCTTCCAT
CATGAAACGAGTAGGTCTAGGTGAAGTTGATGAAACGGAAACATTACTCTCCATTTTTAT
CTTCACAAAAAACACGAGTCTTTGAAAAAAAACTCAATAACTAGGAATTAAATCTAGATC
TAAACAATCACAGTTTACTGA
(381 bp)

- SilkBase 1999-2023 -