SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_TrvaMG_comp119079_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_DNA-directed_RNA_polymerases_I,_II,_and_III_subunit_RPABC4_[Plutella_xylostella]
Ontology
GO:0000398 P mRNA splicing, via spliceosome
GO:0001054 F RNA polymerase I activity
GO:0001055 F RNA polymerase II activity
GO:0001056 F RNA polymerase III activity
GO:0003677 F DNA binding
GO:0003899 F DNA-directed 5'-3' RNA polymerase activity
GO:0005634 C nucleus
GO:0005654 C nucleoplasm
GO:0005665 C RNA polymerase II, core complex
GO:0005666 C RNA polymerase III complex
GO:0005736 C RNA polymerase I complex
GO:0005829 C cytosol
GO:0006283 P transcription-coupled nucleotide-excision repair
GO:0006351 P transcription, DNA-templated
GO:0006356 P regulation of transcription by RNA polymerase I
GO:0006361 P transcription initiation from RNA polymerase I promoter
GO:0006362 P transcription elongation from RNA polymerase I promoter
GO:0006363 P termination of RNA polymerase I transcription
GO:0006366 P transcription by RNA polymerase II
GO:0006367 P transcription initiation from RNA polymerase II promoter
GO:0006368 P transcription elongation from RNA polymerase II promoter
GO:0006370 P 7-methylguanosine mRNA capping
GO:0006383 P transcription by RNA polymerase III
GO:0008270 F zinc ion binding
GO:0008543 P fibroblast growth factor receptor signaling pathway
GO:0010467 P gene expression
GO:0031047 P gene silencing by RNA
GO:0032481 P positive regulation of type I interferon production
GO:0035019 P somatic stem cell population maintenance
GO:0042795 P snRNA transcription by RNA polymerase II
GO:0045815 P epigenetic maintenance of chromatin in transcription-competent conformation
GO:0046872 F metal ion binding
GO:0050434 P positive regulation of viral transcription
Transcript
Level		FPKM:11.11 TPM:9.35
ORF Entry
Sequence
(Nucleotide)
TTTTGTAATTTGTTGGAGTGGTTTTGAAAATTAAGTTTGATATTGAATTCTAAGTTTATA
AAAGTTTCAAACAAGAAATTTTGCAATAATGGCTGACACTAGTGGTAAAGAACAATCGGT
TACTAAAGTACCAATGATATACGTTTGTGGAGAATGCCATAAAGAGAATGAAATCAAACC
GAGAGATCCAATTCGTTGCAGAGAATGTGGATACAGAATTATGTACAAAAAACGCACAAA
GAGATTGGTTGTGTTTGATGCCAGGTGATTTTCATGGAACAGAAGCCTAGAAGATAAGTC
CTACTTTAAGTTTGTGCTGAAGATTGAAATAAATTGATATTAAGGTTAAAAAAAA
(355 bp)

- SilkBase 1999-2023 -