SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_TrvaMG_comp11696_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_DNA_cytosine-5_methyltransferase_isoform_X1_[Bombyx_mori]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0000792 C heterochromatin
GO:0003677 F DNA binding
GO:0003682 F chromatin binding
GO:0003690 F double-stranded DNA binding
GO:0003723 F RNA binding
GO:0003886 F DNA (cytosine-5-)-methyltransferase activity
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005654 C nucleoplasm
GO:0005657 C replication fork
GO:0005721 C pericentric heterochromatin
GO:0005737 C cytoplasm
GO:0006306 P DNA methylation
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0007265 P Ras protein signal transduction
GO:0007420 P brain development
GO:0007568 P aging
GO:0008168 F methyltransferase activity
GO:0008270 F zinc ion binding
GO:0008327 F methyl-CpG binding
GO:0009008 F DNA-methyltransferase activity
GO:0009408 P response to heat
GO:0009636 P response to toxic substance
GO:0010033 P response to organic substance
GO:0010212 P response to ionizing radiation
GO:0010216 P maintenance of DNA methylation
GO:0010288 P response to lead ion
GO:0010424 P DNA methylation on cytosine within a CG sequence
GO:0010468 P regulation of gene expression
GO:0010628 P positive regulation of gene expression
GO:0014823 P response to activity
GO:0016458 P obsolete gene silencing
GO:0016568 P chromatin organization
GO:0016740 F transferase activity
GO:0019904 F protein domain specific binding
GO:0030182 P neuron differentiation
GO:0030331 F estrogen receptor binding
GO:0031000 P response to caffeine
GO:0031667 P response to nutrient levels
GO:0032259 P methylation
GO:0032355 P response to estradiol
GO:0032496 P response to lipopolysaccharide
GO:0032776 P DNA methylation on cytosine
GO:0033189 P response to vitamin A
GO:0033574 P response to testosterone
GO:0036120 P cellular response to platelet-derived growth factor stimulus
GO:0036276 P response to antidepressant
GO:0042127 P regulation of cell population proliferation
GO:0042493 P response to xenobiotic stimulus
GO:0042826 F histone deacetylase binding
GO:0043025 C neuronal cell body
GO:0043234 C protein-containing complex
GO:0044026 P DNA hypermethylation
GO:0045322 F unmethylated CpG binding
GO:0045471 P response to ethanol
GO:0045814 P negative regulation of gene expression, epigenetic
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0046498 P S-adenosylhomocysteine metabolic process
GO:0046499 P S-adenosylmethioninamine metabolic process
GO:0046500 P S-adenosylmethionine metabolic process
GO:0046872 F metal ion binding
GO:0051571 P positive regulation of histone H3-K4 methylation
GO:0051573 P negative regulation of histone H3-K9 methylation
GO:0051718 F DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates
GO:0071230 P cellular response to amino acid stimulus
GO:0071284 P cellular response to lead ion
GO:0071560 P cellular response to transforming growth factor beta stimulus
GO:0090116 P C-5 methylation of cytosine
GO:0090309 P positive regulation of DNA methylation-dependent heterochromatin assembly
GO:1990090 P cellular response to nerve growth factor stimulus
GO:1990841 F promoter-specific chromatin binding
Transcript
Level		FPKM:2.24 TPM:1.89
ORF Entry
Sequence
(Nucleotide)
ATCTTCGCCTAGTCTGAGGAACTCCATAGTTACCGGCTTGTAGGATACCAAACGTACATT
GGTAGCCCATGTCCAATAACGCTCTCAGAGTCAATTTTAAAACCATACCCTTTTTAAAGG
CAACAAAGTTTCGGACATTCTCCAATATAAAATACTTTGGTCGATAATAATCACAGAAGG
ATAAGTACGACGCAACTAACGAATTTTTGAAATTAGAATATTCCCTTGAATTGAATCTGT
TCATTCCAGAGAAACCTTGACATGGTGGACCACCACATAACAGCTCTACTTCTCCTTGCA
TCGGGAGTCGTGATCCATTGGCACTATGTTTATCGCCAGATATTACGCTTTTCAAGAGTG
CATTACAATCTTCATTGAAAACTGTACAATTCTTATTGTTCAGGAAATAAGCGTGCGATG
CGGCTTCGACATTTTCGATGGCCCATTTGCATTCTGCAATCCCAGCTTGATGTAAACCTT
CTGACAAACCTCCACATCCAGCAAACACATCGAGAGTTCGCAAAGGTCTAATTTGCTGAT
CAACAGCTTTACTGGGAATTGATTCAACAGGTTTCGTAGATTTTCCTTTGCCTTTTCCTT
TGTCTTTAGTCCGATCTGTTCTTCCAGCAGTGAGTGCATGTTGTGGAGGATCCACAAACT
CACCAGAAGATTTATTATAAGCCATTCTAAAGTAAAATCTGCATGGATCAAG
(712 bp)

- SilkBase 1999-2023 -