SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_TrvaFAMAMG_TR10165c0_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		tyramine_beta_hydroxylase_precursor_[Bombyx_mori]
Ontology
GO:0001816 P cytokine production
GO:0001974 P blood vessel remodeling
GO:0001975 P response to amphetamine
GO:0002443 P leukocyte mediated immunity
GO:0003824 F catalytic activity
GO:0004497 F monooxygenase activity
GO:0004500 F dopamine beta-monooxygenase activity
GO:0005507 F copper ion binding
GO:0007613 P memory
GO:0007626 P locomotory behavior
GO:0008306 P associative learning
GO:0008542 P visual learning
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016023 C cytoplasmic vesicle
GO:0016491 F oxidoreductase activity
GO:0016715 F oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen
GO:0030658 C transport vesicle membrane
GO:0031410 C cytoplasmic vesicle
GO:0031418 F L-ascorbic acid binding
GO:0034466 C chromaffin granule lumen
GO:0042127 P regulation of cell population proliferation
GO:0042309 P homoiothermy
GO:0042420 P dopamine catabolic process
GO:0042421 P norepinephrine biosynthetic process
GO:0042423 P catecholamine biosynthetic process
GO:0042584 C chromaffin granule membrane
GO:0042593 P glucose homeostasis
GO:0042596 P fear response
GO:0042711 P maternal behavior
GO:0045907 P positive regulation of vasoconstriction
GO:0046872 F metal ion binding
GO:0048149 P behavioral response to ethanol
GO:0048265 P response to pain
GO:0050900 P leukocyte migration
GO:0055114 P obsolete oxidation-reduction process
GO:2001236 P regulation of extrinsic apoptotic signaling pathway
Transcript
Level		FPKM:0.57 TPM:0.56
ORF Entry
Sequence
(Nucleotide)
GTATTGGTGCAAAGTTGTCAAGTTACCAGAATTTGTAACGACCAAAATTCATCATATTAT
TCAGTTTGAGTCAACAATCACTTCGGGTAATGAAGGCTTAGTACACCATATGGAAGTGTT
CTATTGCGACGAAGATCCACATAAAGAAATACCATCCTATGAAGGAAACTGCTTTGCACC
AGATAGACCTAAAATCACTAAGAGTTGTTCGAAGGTAAAAGCGGCATGGGCG
(232 bp)

- SilkBase 1999-2023 -