SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_SariMSG_c23974_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		chromatin-remodeling_complex_ATPase_chain_Iswi_isoform_X2_[Helicoverpa_armigera]
Ontology
GO:0000166 F nucleotide binding
GO:0000790 C chromatin
GO:0003676 F nucleic acid binding
GO:0003677 F DNA binding
GO:0003678 F DNA helicase activity
GO:0004386 F helicase activity
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005667 C transcription regulator complex
GO:0005700 C polytene chromosome
GO:0006325 P chromatin organization
GO:0006333 P chromatin assembly or disassembly
GO:0006334 P nucleosome assembly
GO:0006338 P chromatin remodeling
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0006357 P regulation of transcription by RNA polymerase II
GO:0007517 P muscle organ development
GO:0008094 F ATP-dependent activity, acting on DNA
GO:0008134 F transcription factor binding
GO:0008623 C CHRAC
GO:0016568 P chromatin organization
GO:0016584 P nucleosome positioning
GO:0016589 C NURF complex
GO:0016590 C ACF complex
GO:0016787 F hydrolase activity
GO:0016818 F hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides
GO:0016887 F ATP hydrolysis activity
GO:0019233 P sensory perception of pain
GO:0031010 C ISWI-type complex
GO:0031213 C RSF complex
GO:0031491 F nucleosome binding
GO:0032508 P DNA duplex unwinding
GO:0035060 C brahma complex
GO:0035063 P nuclear speck organization
GO:0035076 P ecdysone receptor-mediated signaling pathway
GO:0042752 P regulation of circadian rhythm
GO:0042766 P nucleosome mobilization
GO:0043044 P chromatin remodeling
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0048813 P dendrite morphogenesis
GO:0070615 F ATP-dependent chromatin remodeler activity
Transcript
Level		FPKM:12.33 TPM:7.87
ORF EntryO_SariMSG10440_5prime_partial:A_SariMSG_c23974_g1_i1
Sequence
(Nucleotide)
GGAAGAAGAAGACAGGTTCTTAGTTTGCATGTTACACAAGTTGGGTTTCGACAAAGAGAA
CGTGTATGAGGAGTTGCGCGCGTCGGTGCACGCGGCGCCGCAGTTCCGGTTCGATTGGTT
CCTCAAATCGCGTACGGCCGTCGAACTACAACGACGGTGTAACACTCTAATTACATTGAT
CGAACGCGAAAATCAAGAATTAGAAGAGAAGGAACGCGCGGAGAAGAAGAAGAAAAGCGG
CAACGCGAATCAGAACACGCCCGGGAATAACGTGACGGGGAAGGGAACGCGCGGAGAAGA
AGAAGAAAAGCGGCAACGCGAATCAGAACACGCCCGGGAATAACGTGACGGGGAAG
(356 bp)

- SilkBase 1999-2023 -