SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_SariMSG_c1141_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		growth_arrest-specific_protein_1-like_[Helicoverpa_armigera]
Ontology
GO:0002053 P positive regulation of mesenchymal cell proliferation
GO:0005515 F protein binding
GO:0005886 C plasma membrane
GO:0007049 P cell cycle
GO:0007050 P regulation of cell cycle
GO:0007411 P axon guidance
GO:0008284 P positive regulation of cell population proliferation
GO:0008589 P regulation of smoothened signaling pathway
GO:0009953 P dorsal/ventral pattern formation
GO:0010955 P negative regulation of protein processing
GO:0012501 P programmed cell death
GO:0016020 C membrane
GO:0021587 P cerebellum morphogenesis
GO:0021904 P dorsal/ventral neural tube patterning
GO:0030308 P negative regulation of cell growth
GO:0031225 C anchored component of membrane
GO:0042473 P outer ear morphogenesis
GO:0042474 P middle ear morphogenesis
GO:0042476 P odontogenesis
GO:0042733 P embryonic digit morphogenesis
GO:0043010 P camera-type eye development
GO:0043066 P negative regulation of apoptotic process
GO:0045165 P cell fate commitment
GO:0045879 P negative regulation of smoothened signaling pathway
GO:0045880 P positive regulation of smoothened signaling pathway
GO:0045930 P negative regulation of mitotic cell cycle
GO:0046658 C anchored component of plasma membrane
GO:0048589 P developmental growth
GO:0048592 P eye morphogenesis
GO:0048598 P embryonic morphogenesis
GO:0048701 P embryonic cranial skeleton morphogenesis
GO:0048706 P embryonic skeletal system development
GO:0050679 P positive regulation of epithelial cell proliferation
GO:0050680 P negative regulation of epithelial cell proliferation
GO:0060021 P roof of mouth development
GO:0060628 P regulation of ER to Golgi vesicle-mediated transport
GO:2001240 P negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
Transcript
Level		FPKM:2.65 TPM:1.69
ORF Entry
Sequence
(Nucleotide)
GCAGTGCGCTACAGCGCTACAATACTATAATCAATTATGTAGATCCATGTTCCGTGGTAG
GAAATGTTCGAATAAATGTCTCAATTCAATCGAGATATTGAGGAAACAGGAGAAAGCTGC
GGCACTCACAGCGTGTCAGTGTGACGGCAACGAAGACGTACGAGACGATTGTACGAGAAT
GCAAAACAATCTGGCGAGGCTCTGTTTTCATAAACATAGAAACCACACCAAAGGCCATGA
TAAGCATGGAGTAAACAAAAAAAAGGTTACGAAGTGATGTAAGCTTCCAG
(290 bp)

- SilkBase 1999-2023 -