SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NameA_SariMSG_c11003_g1_i1
Scaffold_id
NCBI non-redundant
(nr)
clathrin_heavy_chain_[Bombyx_mori]
Ontology
GO:0005198 F structural molecule activity
GO:0005515 F protein binding
GO:0005802 C trans-Golgi network
GO:0005811 C lipid droplet
GO:0005829 C cytosol
GO:0005886 C plasma membrane
GO:0005905 C clathrin-coated pit
GO:0005938 C cell cortex
GO:0006886 P intracellular protein transport
GO:0006897 P endocytosis
GO:0007268 P chemical synaptic transmission
GO:0007269 P neurotransmitter secretion
GO:0007291 P sperm individualization
GO:0007594 P puparial adhesion
GO:0008021 C synaptic vesicle
GO:0008103 P oocyte microtubule cytoskeleton polarization
GO:0016020 C membrane
GO:0016079 P synaptic vesicle exocytosis
GO:0016183 P synaptic vesicle coating
GO:0016192 P vesicle-mediated transport
GO:0030125 C clathrin vesicle coat
GO:0030129 C clathrin coat of synaptic vesicle
GO:0030130 C clathrin coat of trans-Golgi network vesicle
GO:0030132 C clathrin coat of coated pit
GO:0030135 C coated vesicle
GO:0030136 C clathrin-coated vesicle
GO:0030141 C secretory granule
GO:0030198 P extracellular matrix organization
GO:0030659 C cytoplasmic vesicle membrane
GO:0031410 C cytoplasmic vesicle
GO:0032051 F clathrin light chain binding
GO:0033227 P dsRNA transport
GO:0033363 P secretory granule organization
GO:0035002 P liquid clearance, open tracheal system
GO:0035159 P regulation of tube length, open tracheal system
GO:0040008 P regulation of growth
GO:0045451 P pole plasm oskar mRNA localization
GO:0045747 P positive regulation of Notch signaling pathway
GO:0045807 P positive regulation of endocytosis
GO:0046667 P compound eye retinal cell programmed cell death
GO:0048471 C perinuclear region of cytoplasm
GO:0048749 P compound eye development
GO:0071439 C clathrin complex
Transcript
Level
FPKM:2.13 TPM:1.36
ORF Entry
Sequence
(Nucleotide)
AACCCGAGGTTGCAGAAGAACTCCTTAATTGGTTCCTGGAAAGAGACAATTTCGAATGCT
TCTCCGCTTGTTTATACCAGTGTTACGATCTCCTTAAACCTGATGTCGTCATCGAGCTCG
CGTGGAGACATAATATTATGGACTTCGCCATGCCGTTCCTTATTCAGACAGTCCGTGAGT
TGACTACCAAAGTAGAAAAACTTGAAGAAGCCGACGCAAAACGCAGCACTGAAAGTGCGG
AACATGAAGCAAAACCCACCATGATCATTGAACCACAACTGATGCTTACAGCCGG
(295 bp)

- SilkBase 1999-2023 -