SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_SariMG_comp12501_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_glutamate_receptor_ionotropic,_kainate_2-like_[Papilio_polytes]
Ontology
GO:0001919 P regulation of receptor recycling
GO:0004872 F signaling receptor activity
GO:0004970 F ionotropic glutamate receptor activity
GO:0004971 F AMPA glutamate receptor activity
GO:0005216 F ion channel activity
GO:0005234 F extracellularly glutamate-gated ion channel activity
GO:0005246 F calcium channel regulator activity
GO:0005515 F protein binding
GO:0005783 C endoplasmic reticulum
GO:0005789 C endoplasmic reticulum membrane
GO:0005886 C plasma membrane
GO:0005887 C integral component of plasma membrane
GO:0006810 P transport
GO:0006811 P ion transport
GO:0007268 P chemical synaptic transmission
GO:0008328 C ionotropic glutamate receptor complex
GO:0009986 C cell surface
GO:0010226 P response to lithium ion
GO:0014069 C postsynaptic density
GO:0015277 F kainate selective glutamate receptor activity
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0019901 F protein kinase binding
GO:0030054 C cell junction
GO:0030165 F PDZ domain binding
GO:0030425 C dendrite
GO:0030426 C growth cone
GO:0030672 C synaptic vesicle membrane
GO:0031623 P receptor internalization
GO:0032279 C asymmetric synapse
GO:0032281 C AMPA glutamate receptor complex
GO:0032839 C dendrite cytoplasm
GO:0034220 P ion transmembrane transport
GO:0035235 P ionotropic glutamate receptor signaling pathway
GO:0042734 C presynaptic membrane
GO:0042802 F identical protein binding
GO:0043025 C neuronal cell body
GO:0043195 C terminal bouton
GO:0043197 C dendritic spine
GO:0043198 C dendritic shaft
GO:0043204 C perikaryon
GO:0043234 C protein-containing complex
GO:0045184 P establishment of protein localization
GO:0045202 C synapse
GO:0045211 C postsynaptic membrane
GO:0050806 P positive regulation of synaptic transmission
GO:0051262 P protein tetramerization
GO:0051966 P regulation of synaptic transmission, glutamatergic
GO:0060992 P response to fungicide
Transcript
Level		FPKM:0.83 TPM:0.83
ORF Entry
Sequence
(Nucleotide)
ACAATTGTATGTGGTTAACGATGGGCTCAATTATGACTCAGGGCTGTGATATATTGCCAA
GAGCGGCAGGATCTCGTTGGGTGACCGGAATGTGGTGGTTCTTTGCCATGATCGTAACTG
CATCGTACACTGCCAACATGTCTATGTTTTTAAGTAACAATCGTCGAAGCAATGATATCA
CGAACATCCAAGAGCTCTCTGAACAAACTAAAGTATCCTACGGAACTGTG
(230 bp)

- SilkBase 1999-2023 -