SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_SariMG_comp111244_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_myosin_heavy_chain,_muscle_isoform_X12_[Plutella_xylostella]
Ontology
GO:0000146 F microfilament motor activity
GO:0000166 F nucleotide binding
GO:0001725 C stress fiber
GO:0002026 P regulation of the force of heart contraction
GO:0002027 P regulation of heart rate
GO:0003009 P skeletal muscle contraction
GO:0003774 F cytoskeletal motor activity
GO:0003779 F actin binding
GO:0005515 F protein binding
GO:0005516 F calmodulin binding
GO:0005524 F ATP binding
GO:0005737 C cytoplasm
GO:0005859 C muscle myosin complex
GO:0006936 P muscle contraction
GO:0006941 P striated muscle contraction
GO:0007512 P adult heart development
GO:0014728 P regulation of the force of skeletal muscle contraction
GO:0014883 P transition between fast and slow fiber
GO:0016459 C myosin complex
GO:0016887 F ATP hydrolysis activity
GO:0030016 C myofibril
GO:0030017 C sarcomere
GO:0030018 C Z disc
GO:0030049 P muscle filament sliding
GO:0030898 F microfilament motor activity
GO:0031449 P regulation of slow-twitch skeletal muscle fiber contraction
GO:0032982 C myosin filament
GO:0042803 F protein homodimerization activity
GO:0046034 P ATP metabolic process
GO:0046982 F protein heterodimerization activity
GO:0055010 P ventricular cardiac muscle tissue morphogenesis
GO:0060048 P cardiac muscle contraction
Transcript
Level		FPKM:4.62 TPM:4.63
ORF Entry
Sequence
(Nucleotide)
GAAATCTTCGACTTCAACGGTTTCGAACAACTCTGCATTAACTTCACCAATGAGAAACTG
CAGCAGTTCTTTAACCACCACATGTTCGTACTCGAGCAAGAGGAGTACAAGAGAGAGGGC
ATCGAATGGACCTTCATCGATTTCGGCATGGACTTGTTAGCTTGTATCGATCTTATCGAG
AAGCCTATGGGTATCCTCTCCATC
(204 bp)

- SilkBase 1999-2023 -