SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NameA_SariMG_comp1094736_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)
Protein_kinase_C_alpha_binding_protein,_partial_[Operophtera_brumata]
Ontology
GO:0001664 F G protein-coupled receptor binding
GO:0002092 P positive regulation of receptor internalization
GO:0003779 F actin binding
GO:0005080 F protein kinase C binding
GO:0005102 F signaling receptor binding
GO:0005515 F protein binding
GO:0005737 C cytoplasm
GO:0005794 C Golgi apparatus
GO:0005856 C cytoskeleton
GO:0005886 C plasma membrane
GO:0006468 P protein phosphorylation
GO:0007205 P protein kinase C-activating G protein-coupled receptor signaling pathway
GO:0008022 F protein C-terminus binding
GO:0010629 P negative regulation of gene expression
GO:0014069 C postsynaptic density
GO:0015844 P monoamine transport
GO:0015872 P dopamine transport
GO:0016020 C membrane
GO:0016887 F ATP hydrolysis activity
GO:0019904 F protein domain specific binding
GO:0021782 P glial cell development
GO:0030054 C cell junction
GO:0030425 C dendrite
GO:0030971 F receptor tyrosine kinase binding
GO:0034316 P negative regulation of Arp2/3 complex-mediated actin nucleation
GO:0035256 F G protein-coupled glutamate receptor binding
GO:0036294 P cellular response to decreased oxygen levels
GO:0042149 P cellular response to glucose starvation
GO:0042734 C presynaptic membrane
GO:0042802 F identical protein binding
GO:0043005 C neuron projection
GO:0043113 P receptor clustering
GO:0043234 C protein-containing complex
GO:0045202 C synapse
GO:0045211 C postsynaptic membrane
GO:0046872 F metal ion binding
GO:0046875 F ephrin receptor binding
GO:0048471 C perinuclear region of cytoplasm
GO:0051015 F actin filament binding
GO:0051020 F GTPase binding
GO:0060292 P long-term synaptic depression
GO:0060548 P negative regulation of cell death
GO:0071933 F Arp2/3 complex binding
GO:0097061 P dendritic spine organization
GO:0097062 P dendritic spine maintenance
Transcript
Level
FPKM:0.82 TPM:0.82
ORF Entry
Sequence
(Nucleotide)
GTGACAATAAACTACAACAAACTTCACGCGGACCCAAAACAGGGTAAATCCCTCGATATA
ATAATGAAAAAAATGAAACATCGACTGGTAGAGAATATGTCGTCGGGAGCGGCCGACGCT
TTGGGCTTGTCCAGGGCAATTTTATGCAACGACACTTTAGTCGCTAAGTTGAATGAACTA
AGAGATACGGAAACAACTTATAAGAGACTAGTGGAGCATGCTAAAAGAATG
(231 bp)

- SilkBase 1999-2023 -