SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NameA_SariASG_c17546_g1_i1
Scaffold_id
NCBI non-redundant
(nr)
Semaphorin-5c_[Operophtera_brumata]
Ontology
GO:0001755 P neural crest cell migration
GO:0001938 P positive regulation of endothelial cell proliferation
GO:0002043 P blood vessel endothelial cell proliferation involved in sprouting angiogenesis
GO:0005886 C plasma membrane
GO:0007155 P cell adhesion
GO:0007162 P negative regulation of cell adhesion
GO:0007267 P cell-cell signaling
GO:0007275 P multicellular organism development
GO:0007399 P nervous system development
GO:0007413 P axonal fasciculation
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0021536 P diencephalon development
GO:0030154 P cell differentiation
GO:0030215 F semaphorin receptor binding
GO:0030335 P positive regulation of cell migration
GO:0030836 P positive regulation of actin filament depolymerization
GO:0035373 F chondroitin sulfate proteoglycan binding
GO:0035413 P positive regulation of canonical Wnt signaling pathway
GO:0043395 F heparan sulfate proteoglycan binding
GO:0045499 F chemorepellent activity
GO:0045545 F syndecan binding
GO:0045766 P positive regulation of angiogenesis
GO:0048842 P positive regulation of axon extension involved in axon guidance
GO:0048843 P negative regulation of axon extension involved in axon guidance
GO:0050918 P positive chemotaxis
GO:0050919 P negative chemotaxis
GO:0051897 P positive regulation of protein kinase B signaling
GO:0060326 P cell chemotaxis
GO:0070062 C extracellular exosome
GO:0071526 P semaphorin-plexin signaling pathway
GO:1990256 P signal clustering
GO:2000352 P negative regulation of endothelial cell apoptotic process
GO:2001028 P positive regulation of endothelial cell chemotaxis
Transcript
Level
FPKM:3.69 TPM:3.57
ORF Entry
Sequence
(Nucleotide)
ACGGCGGCCTCGACTGCGACGGAGCTAAAACCGAACGGCAGGTCTGCGACATGCGACCCT
GTGACGTCAAGAAGACCACCGCCTGGACACCCTGGGTGCATATACCACGCAACACTTCGG
ATGGCAGTTACACAGAGAAAAGATTCAAGTTCCTTTGCCGGGCGTCGCCAGAGCAGCAAG
TAAAATTAAATTTGTCAATAGTGAGAGAGGAG
(212 bp)

- SilkBase 1999-2023 -