SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NameA_SariASG_c16723_g1_i2
Scaffold_id
NCBI non-redundant
(nr)
HMGB2,_partial_[Cervus_elaphus_hippelaphus]
Ontology
GO:0000400 F four-way junction DNA binding
GO:0000790 C chromatin
GO:0000793 C condensed chromosome
GO:0001158 F cis-regulatory region sequence-specific DNA binding
GO:0001938 P positive regulation of endothelial cell proliferation
GO:0002376 P immune system process
GO:0002437 P inflammatory response to antigenic stimulus
GO:0003677 F DNA binding
GO:0003684 F damaged DNA binding
GO:0003690 F double-stranded DNA binding
GO:0003697 F single-stranded DNA binding
GO:0003700 F DNA-binding transcription factor activity
GO:0005515 F protein binding
GO:0005576 C extracellular region
GO:0005615 C extracellular space
GO:0005623 C obsolete cell
GO:0005634 C nucleus
GO:0005654 C nucleoplasm
GO:0005694 C chromosome
GO:0005730 C nucleolus
GO:0005737 C cytoplasm
GO:0006265 P DNA topological change
GO:0006309 P apoptotic DNA fragmentation
GO:0006310 P DNA recombination
GO:0006325 P chromatin organization
GO:0006334 P nucleosome assembly
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0006357 P regulation of transcription by RNA polymerase II
GO:0006935 P chemotaxis
GO:0006954 P inflammatory response
GO:0007283 P spermatogenesis
GO:0007289 P spermatid nucleus differentiation
GO:0008134 F transcription factor binding
GO:0008144 F obsolete drug binding
GO:0008301 F DNA binding, bending
GO:0008584 P male gonad development
GO:0010628 P positive regulation of gene expression
GO:0010629 P negative regulation of gene expression
GO:0019904 F protein domain specific binding
GO:0032075 P positive regulation of nuclease activity
GO:0032392 P DNA geometric change
GO:0032496 P response to lipopolysaccharide
GO:0032728 P positive regulation of interferon-beta production
GO:0033151 P V(D)J recombination
GO:0042056 F chemoattractant activity
GO:0042493 P response to xenobiotic stimulus
GO:0043234 C protein-containing complex
GO:0043388 P positive regulation of DNA binding
GO:0044212 F transcription cis-regulatory region binding
GO:0044378 F non-sequence-specific DNA binding, bending
GO:0044822 F RNA binding
GO:0045087 P innate immune response
GO:0045089 P positive regulation of innate immune response
GO:0045595 P regulation of cell differentiation
GO:0045648 P positive regulation of erythrocyte differentiation
GO:0045654 P positive regulation of megakaryocyte differentiation
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0048471 C perinuclear region of cytoplasm
GO:0048545 P response to steroid hormone
GO:0050767 P regulation of neurogenesis
GO:0050786 F RAGE receptor binding
GO:0050829 P defense response to Gram-negative bacterium
GO:0050830 P defense response to Gram-positive bacterium
GO:0050918 P positive chemotaxis
GO:0051103 P DNA ligation involved in DNA repair
GO:0060326 P cell chemotaxis
GO:0071222 P cellular response to lipopolysaccharide
GO:0072091 P regulation of stem cell proliferation
GO:0097100 F supercoiled DNA binding
GO:1902042 P negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
Transcript
Level
FPKM:2.29 TPM:2.21
ORF Entry
Sequence
(Nucleotide)
GAAGATAAACAACCGTACTGCCAAAGATAAACAACCGTATGAGCAGAAAGCAGCTAAACT
AAAGGAGAAGTATGAAAAGGATATTGCTGCATACCGTGCCAAGGGCAAAAGTGAAGCAGG
AAAGAAGGGTCCTGGTAGGCCAACAGGCTCAAAGAAGAAGAACGAACCAGAAGATGAGGA
GGAGGAAGAAGAGGAGGAAGAGGAGGAAGATGACGAGGAAGAAGAGGAGGATGAAGAATA
AGTGGCAGATCGGAAG
(256 bp)

- SilkBase 1999-2023 -