SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_SariASG_c16715_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		E3_ubiquitin-protein_ligase_NEDD4_isoform_X2_[Meriones_unguiculatus]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0000151 C ubiquitin ligase complex
GO:0000785 C chromatin
GO:0002250 P adaptive immune response
GO:0003151 P outflow tract morphogenesis
GO:0003197 P endocardial cushion development
GO:0004842 F ubiquitin-protein transferase activity
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005794 C Golgi apparatus
GO:0005829 C cytosol
GO:0005886 C plasma membrane
GO:0005902 C microvillus
GO:0005938 C cell cortex
GO:0006513 P protein monoubiquitination
GO:0006622 P protein targeting to lysosome
GO:0006955 P immune response
GO:0007041 P lysosomal transport
GO:0007399 P nervous system development
GO:0007528 P neuromuscular junction development
GO:0008022 F protein C-terminus binding
GO:0010766 P negative regulation of sodium ion transport
GO:0010768 P negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage
GO:0014068 P positive regulation of phosphatidylinositol 3-kinase signaling
GO:0014894 P response to denervation involved in regulation of muscle adaptation
GO:0016020 C membrane
GO:0016567 P protein ubiquitination
GO:0016874 F ligase activity
GO:0019089 P obsolete transmission of virus
GO:0019871 F sodium channel inhibitor activity
GO:0019904 F protein domain specific binding
GO:0030948 P negative regulation of vascular endothelial growth factor receptor signaling pathway
GO:0031175 P neuron projection development
GO:0031623 P receptor internalization
GO:0031698 F beta-2 adrenergic receptor binding
GO:0032801 P receptor catabolic process
GO:0034644 P cellular response to UV
GO:0034765 P regulation of ion transmembrane transport
GO:0035255 F ionotropic glutamate receptor binding
GO:0042110 P T cell activation
GO:0042391 P regulation of membrane potential
GO:0042787 P ubiquitin-dependent protein catabolic process
GO:0042921 P glucocorticoid receptor signaling pathway
GO:0043130 F ubiquitin binding
GO:0043162 P ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway
GO:0044111 P formation of structure involved in a symbiotic process
GO:0045121 C membrane raft
GO:0045732 P positive regulation of protein catabolic process
GO:0046824 P positive regulation of nucleocytoplasmic transport
GO:0048471 C perinuclear region of cytoplasm
GO:0048514 P blood vessel morphogenesis
GO:0048814 P regulation of dendrite morphogenesis
GO:0050807 P regulation of synapse organization
GO:0050815 F phosphoserine residue binding
GO:0050816 F phosphothreonine residue binding
GO:0050847 P progesterone receptor signaling pathway
GO:0061630 F ubiquitin protein ligase activity
GO:0070062 C extracellular exosome
GO:0070063 F RNA polymerase binding
GO:0070064 F proline-rich region binding
GO:0070534 P protein K63-linked ubiquitination
GO:1901016 P regulation of potassium ion transmembrane transporter activity
GO:2000650 P negative regulation of sodium ion transmembrane transporter activity
Transcript
Level		FPKM:0.79 TPM:0.77
ORF Entry
Sequence
(Nucleotide)
TCCGTCCGTTTTACAAGATGATGCTTCAGAAACTGATAACACTGCACGACATGGAGTCCG
TGGATAGTGAATATTACAGTTCTCTGCGATGGATTCTTGAAAATGACCCGACGGAGCTGG
ACCTGAGATTTATCATAGATGAAGAACTTTTTGGACAGACACATTAGCACGAACTGAAAA
CCGGAGGATCAGAGATTGTTGTCACCAATAAGAACAAAAAGGAGTATATCTACCTTGTAA
TACAATGGCGATTTGTGAACCGTATCCAGAAGCAAATGGCAGCTTTTAAAGAGGGATTTT
TTGAACTGATACCACAGGATCTCATCAAG
(329 bp)

- SilkBase 1999-2023 -