SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NameA_SariASG_c1539_g1_i1
Scaffold_id
NCBI non-redundant
(nr)
teneurin-m_isoform_X4_[Helicoverpa_armigera]
Ontology
GO:0001745 P compound eye morphogenesis
GO:0001941 P postsynaptic membrane organization
GO:0005515 F protein binding
GO:0005578 C extracellular matrix
GO:0005737 C cytoplasm
GO:0005886 C plasma membrane
GO:0005887 C integral component of plasma membrane
GO:0007155 P cell adhesion
GO:0007274 P neuromuscular synaptic transmission
GO:0007275 P multicellular organism development
GO:0007399 P nervous system development
GO:0008039 P synaptic target recognition
GO:0008045 P motor neuron axon guidance
GO:0008360 P regulation of cell shape
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016200 P synaptic target attraction
GO:0019233 P sensory perception of pain
GO:0022416 P chaeta development
GO:0030054 C cell junction
GO:0031005 F filamin binding
GO:0031122 P cytoplasmic microtubule organization
GO:0031594 C neuromuscular junction
GO:0034110 P regulation of homotypic cell-cell adhesion
GO:0034116 P positive regulation of heterotypic cell-cell adhesion
GO:0040017 P positive regulation of locomotion
GO:0042051 P compound eye photoreceptor development
GO:0042802 F identical protein binding
GO:0042803 F protein homodimerization activity
GO:0043005 C neuron projection
GO:0043025 C neuronal cell body
GO:0045202 C synapse
GO:0045211 C postsynaptic membrane
GO:0045467 P R7 cell development
GO:0046982 F protein heterodimerization activity
GO:0048058 P compound eye corneal lens development
GO:0048499 P synaptic vesicle membrane organization
GO:0048790 P maintenance of presynaptic active zone structure
GO:0050808 P synapse organization
GO:0051124 P synaptic assembly at neuromuscular junction
GO:0097090 P presynaptic membrane organization
GO:2000331 P regulation of terminal button organization
Transcript
Level
FPKM:4.09 TPM:3.96
ORF Entry
Sequence
(Nucleotide)
CCTGCGTGAGAGGTTACAAAGGCAAGTTCTGCGGAGACATCGACTGTCCACACCCGACGT
GCTCCGGTCACGGGTTCTGTATCGAAGGGTCGTGTGTTTGCAAAAAGGGTTGGAAGGGAA
CCGACTGCGCGACGATGGACAAGGATGCGCTGCAATGCCTTCCAGACTGTTCTGGGCATG
GAACTTTCGACGTCGATACTCAAAC
(205 bp)

- SilkBase 1999-2023 -