SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_SariASG_c13995_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		calreticulin,_isoform_CRA_b_[Rattus_norvegicus]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0001669 C acrosomal vesicle
GO:0001948 F protein binding
GO:0002479 P antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent
GO:0002502 P peptide antigen assembly with MHC class I protein complex
GO:0003729 F mRNA binding
GO:0005178 F integrin binding
GO:0005506 F iron ion binding
GO:0005509 F calcium ion binding
GO:0005515 F protein binding
GO:0005576 C extracellular region
GO:0005615 C extracellular space
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005783 C endoplasmic reticulum
GO:0005788 C endoplasmic reticulum lumen
GO:0005790 C smooth endoplasmic reticulum
GO:0005794 C Golgi apparatus
GO:0005829 C cytosol
GO:0005844 C polysome
GO:0005925 C focal adhesion
GO:0006457 P protein folding
GO:0006611 P protein export from nucleus
GO:0006898 P receptor-mediated endocytosis
GO:0007050 P regulation of cell cycle
GO:0007283 P spermatogenesis
GO:0008284 P positive regulation of cell population proliferation
GO:0009897 C external side of plasma membrane
GO:0009986 C cell surface
GO:0010033 P response to organic substance
GO:0010628 P positive regulation of gene expression
GO:0016020 C membrane
GO:0016529 C sarcoplasmic reticulum
GO:0017148 P negative regulation of translation
GO:0030246 F carbohydrate binding
GO:0030866 P cortical actin cytoskeleton organization
GO:0031012 C extracellular matrix
GO:0031625 F ubiquitin protein ligase binding
GO:0032355 P response to estradiol
GO:0033018 C sarcoplasmic reticulum lumen
GO:0033144 P negative regulation of intracellular steroid hormone receptor signaling pathway
GO:0033574 P response to testosterone
GO:0034504 P protein localization to nucleus
GO:0040020 P regulation of meiotic nuclear division
GO:0042277 F peptide binding
GO:0042493 P response to xenobiotic stimulus
GO:0042562 F hormone binding
GO:0042824 C MHC class I peptide loading complex
GO:0043231 C intracellular membrane-bounded organelle
GO:0043234 C protein-containing complex
GO:0044822 F RNA binding
GO:0045335 C phagocytic vesicle
GO:0045665 P negative regulation of neuron differentiation
GO:0045740 P positive regulation of DNA replication
GO:0045787 P positive regulation of cell cycle
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0046872 F metal ion binding
GO:0048387 P negative regulation of retinoic acid receptor signaling pathway
GO:0048471 C perinuclear region of cytoplasm
GO:0050681 F androgen receptor binding
GO:0050766 P positive regulation of phagocytosis
GO:0050821 P protein stabilization
GO:0051082 F unfolded protein binding
GO:0055007 P cardiac muscle cell differentiation
GO:0061077 P chaperone-mediated protein folding
GO:0070062 C extracellular exosome
GO:0071285 P cellular response to lithium ion
GO:0071310 P cellular response to organic substance
GO:0090398 P cellular senescence
GO:1900026 P positive regulation of substrate adhesion-dependent cell spreading
GO:1901224 P positive regulation of NIK/NF-kappaB signaling
GO:2000510 P positive regulation of dendritic cell chemotaxis
Transcript
Level		FPKM:2.04 TPM:1.97
ORF Entry
Sequence
(Nucleotide)
GCTCCTTTCGGTGCCGCTCCTGCTTGGCCTCCTCGGCCTGGTCGCCGCAGACCCTGCCAT
CTATTTCAAAGAGCAGTTCTTGGACGGAGATGCCTGGACCAACCGCTGGGTCGAATCCAA
ACATAAGTCCGATTTTGGCAAATTTGTCCTCAGTTCTGGCAAATTTTACGGGGACCTGGA
GAAGGATAAAGGGCTGCAGACAAGCCAAGATGCCCGAT
(218 bp)

- SilkBase 1999-2023 -