SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_SariASG_c13408_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_G_protein-activated_inward_rectifier_potassium_channel_3-like_isoform_X4_[Papilio_polytes]
Ontology
GO:0005242 F inward rectifier potassium channel activity
GO:0005244 F voltage-gated ion channel activity
GO:0005249 F voltage-gated potassium channel activity
GO:0005524 F ATP binding
GO:0005886 C plasma membrane
GO:0006006 P glucose metabolic process
GO:0006810 P transport
GO:0006811 P ion transport
GO:0006813 P potassium ion transport
GO:0008076 C voltage-gated potassium channel complex
GO:0008282 C inward rectifying potassium channel
GO:0010107 P potassium ion import across plasma membrane
GO:0015272 F ATP-activated inward rectifier potassium channel activity
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0030315 C T-tubule
GO:0030506 F ankyrin binding
GO:0033198 P response to ATP
GO:0034765 P regulation of ion transmembrane transport
GO:0042391 P regulation of membrane potential
GO:0042493 P response to xenobiotic stimulus
GO:0044325 F transmembrane transporter binding
GO:0046676 P negative regulation of insulin secretion
GO:0050796 P regulation of insulin secretion
GO:0050877 P nervous system process
GO:0071805 P potassium ion transmembrane transport
Transcript
Level		FPKM:1.57 TPM:1.52
ORF Entry
Sequence
(Nucleotide)
CAACAGGGCAGACGACACAGGCGAGATCGAGTTACACAACAAGTGAAATAATGTGGGGAC
ATAGATTTGTGCCGCTAGTGTCATACAATCGTGAGCGACAGGGTTACGAAGTAGATTATT
CAAAATTCGACGAGACGGCACAGGTGGATACTCCGCTTTGCTCGGCCAAAGAACTGGACG
AGTTTTACGGTAGTCAAGCGGAACGGAGATCAATTGAGAGCACGAGATCGGAAGAGCGTC
(240 bp)

- SilkBase 1999-2023 -