SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_SariASG_c11589_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		voltage-dependent_anion_channel_1,_isoform_CRA_a_[Mus_musculus]
Ontology
GO:0000166 F nucleotide binding
GO:0001662 P behavioral fear response
GO:0005253 F anion channel activity
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005739 C mitochondrion
GO:0005741 C mitochondrial outer membrane
GO:0005743 C mitochondrial inner membrane
GO:0005886 C plasma membrane
GO:0006810 P transport
GO:0006811 P ion transport
GO:0006820 P anion transport
GO:0006851 P mitochondrial calcium ion transmembrane transport
GO:0006915 P apoptotic process
GO:0007268 P chemical synaptic transmission
GO:0007270 P neuron-neuron synaptic transmission
GO:0007612 P learning
GO:0008021 C synaptic vesicle
GO:0008308 F voltage-gated anion channel activity
GO:0015288 F porin activity
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0019901 F protein kinase binding
GO:0030855 P epithelial cell differentiation
GO:0032403 F protein-containing complex binding
GO:0042645 C mitochondrial nucleoid
GO:0043209 C myelin sheath
GO:0043234 C protein-containing complex
GO:0044070 P regulation of anion transport
GO:0044325 F transmembrane transporter binding
GO:0045121 C membrane raft
GO:0046930 C pore complex
GO:0055085 P transmembrane transport
GO:0070062 C extracellular exosome
GO:0098656 P anion transmembrane transport
GO:1903146 P regulation of autophagy of mitochondrion
GO:1903959 P regulation of anion transmembrane transport
GO:2000378 P negative regulation of reactive oxygen species metabolic process
Transcript
Level		FPKM:4.13 TPM:4.00
ORF Entry
Sequence
(Nucleotide)
CTTGGCAAGTCCGCCAGGGATGTCTTCACCAAGGGCTACGGCTTTGGCTTAATAAAACTT
GATTTGAAAACGAAGTCAGAGAATGGATTGGAATTTACCAGCTCAGGCTCTGCCAACACG
GAAACCACCAAAGTGAACGGCAGCCTGGAAACCAAGTACAGATGGACTGAGTATGGGCTG
ACGTTTACAGAGAAGTGGAACACAGACAACACCCTGG
(217 bp)

- SilkBase 1999-2023 -