SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_SariASG_c1100_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		zinc_finger_protein_99-like_[Helicoverpa_armigera]
Ontology
GO:0000987 F cis-regulatory region sequence-specific DNA binding
GO:0001077 F DNA-binding transcription activator activity, RNA polymerase II-specific
GO:0003676 F nucleic acid binding
GO:0003677 F DNA binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0006038 P cell wall chitin biosynthetic process
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0006366 P transcription by RNA polymerase II
GO:0007329 P positive regulation of transcription from RNA polymerase II promoter by pheromones
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0046872 F metal ion binding
GO:0050801 P ion homeostasis
GO:0061400 P positive regulation of transcription from RNA polymerase II promoter in response to calcium ion
GO:0061404 P obsolete positive regulation of transcription from RNA polymerase II promoter in response to increased salt
GO:0061422 P positive regulation of transcription from RNA polymerase II promoter in response to alkaline pH
GO:0061423 P positive regulation of sodium ion transport by positive regulation of transcription from RNA polymerase II promoter
GO:0071483 P cellular response to blue light
GO:0097301 P regulation of potassium ion concentration by positive regulation of transcription from RNA polymerase II promoter
GO:1900622 P positive regulation of transcription from RNA polymerase II promoter by calcium-mediated signaling
GO:2001040 P positive regulation of cellular response to drug
Transcript
Level		FPKM:1.28 TPM:1.24
ORF Entry
Sequence
(Nucleotide)
CTCAGGGAGCATATGCGAATACATGAGAATGATAGACGGTTCGTGTGTAGCATATGCGGT
AGATCCTTCGTTCAGAATTGCAGTTTGAAGCATCACACGAAGATTCATCACCCGGTCGAT
GTGCAGACGATGAAAGTGAACACGTTTGTGAAGTGACGAATGTTTAAAAAAACATTTTGC
TTTTCATGAGACAAATGTTGATGATATTATAATGATAGGAACCGCGTATCGACTGACATG
AGCGCTATGGGGCTATGCGAC
(261 bp)

- SilkBase 1999-2023 -