SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_SariASG_c10883_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		DNA_topoisomerase_IIalpha,_partial_[Mus_musculus]
Ontology
GO:0000166 F nucleotide binding
GO:0000228 C nuclear chromosome
GO:0000287 F magnesium ion binding
GO:0000712 P resolution of meiotic recombination intermediates
GO:0000793 C condensed chromosome
GO:0000819 P sister chromatid segregation
GO:0002244 P hematopoietic progenitor cell differentiation
GO:0003677 F DNA binding
GO:0003682 F chromatin binding
GO:0003916 F DNA topoisomerase activity
GO:0003918 F DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity
GO:0005080 F protein kinase C binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005654 C nucleoplasm
GO:0005730 C nucleolus
GO:0005814 C centriole
GO:0006259 P DNA metabolic process
GO:0006265 P DNA topological change
GO:0006266 P DNA ligation
GO:0006268 P DNA unwinding involved in DNA replication
GO:0006312 P mitotic recombination
GO:0006974 P cellular response to DNA damage stimulus
GO:0007059 P chromosome segregation
GO:0008022 F protein C-terminus binding
GO:0008094 F ATP-dependent activity, acting on DNA
GO:0008144 F obsolete drug binding
GO:0008301 F DNA binding, bending
GO:0009295 C nucleoid
GO:0009330 C DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex
GO:0016853 F isomerase activity
GO:0016925 P protein sumoylation
GO:0019899 F enzyme binding
GO:0030261 P chromosome condensation
GO:0030263 P apoptotic chromosome condensation
GO:0040016 P embryonic cleavage
GO:0042752 P regulation of circadian rhythm
GO:0042803 F protein homodimerization activity
GO:0042826 F histone deacetylase binding
GO:0043065 P positive regulation of apoptotic process
GO:0043130 F ubiquitin binding
GO:0043234 C protein-containing complex
GO:0044774 P mitotic DNA integrity checkpoint signaling
GO:0044822 F RNA binding
GO:0045070 P positive regulation of viral genome replication
GO:0045870 P positive regulation of single stranded viral RNA replication via double stranded DNA intermediate
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0046872 F metal ion binding
GO:0046982 F protein heterodimerization activity
GO:0048511 P rhythmic process
Transcript
Level		FPKM:0.82 TPM:0.79
ORF Entry
Sequence
(Nucleotide)
TGAAGACCCAGGGAAGCTCCATGTCGGTAGTTGATCTTGAAAGTGATGTTAAGGACAGTG
TGCCAGCTTCTCCAGGCGTTCCTGCTGCTGACTTCCCAGCGGAAACTGAACAGTCAAAGC
CATCCAAAAAGACCGTGGGAGTGAAGAAGACAGCAACCAAAAGCCAGTCTTCAGTCTCCA
CTGCTGGTACCAAAAAGAGAGCTGCGCCAAAGGGAACCAAATCAGATTCAGCCTTGAGTG
CTCGTGTCTCGGAAAAACCTGCTCCT
(266 bp)

- SilkBase 1999-2023 -