SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NameA_SariASG_c10371_g1_i1
Scaffold_id
NCBI non-redundant
(nr)
PREDICTED:_muscle_M-line_assembly_protein_unc-89-like_isoform_X1_[Papilio_polytes]
Ontology
GO:0000166 F nucleotide binding
GO:0000794 C condensed nuclear chromosome
GO:0001701 P in utero embryonic development
GO:0001756 P somitogenesis
GO:0002020 F protease binding
GO:0003007 P heart morphogenesis
GO:0003300 P cardiac muscle hypertrophy
GO:0004672 F protein kinase activity
GO:0004674 F protein serine/threonine kinase activity
GO:0004713 F protein tyrosine kinase activity
GO:0005200 F structural constituent of cytoskeleton
GO:0005509 F calcium ion binding
GO:0005515 F protein binding
GO:0005516 F calmodulin binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005859 C muscle myosin complex
GO:0005865 C striated muscle thin filament
GO:0006468 P protein phosphorylation
GO:0006936 P muscle contraction
GO:0006941 P striated muscle contraction
GO:0007507 P heart development
GO:0007512 P adult heart development
GO:0008307 F structural constituent of muscle
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016740 F transferase activity
GO:0018108 P peptidyl-tyrosine phosphorylation
GO:0019899 F enzyme binding
GO:0019901 F protein kinase binding
GO:0021591 P ventricular system development
GO:0030017 C sarcomere
GO:0030018 C Z disc
GO:0030240 P skeletal muscle thin filament assembly
GO:0030241 P skeletal muscle myosin thick filament assembly
GO:0030506 F ankyrin binding
GO:0031430 C M band
GO:0031433 F telethonin binding
GO:0031672 C A band
GO:0031674 C I band
GO:0035995 P detection of muscle stretch
GO:0042802 F identical protein binding
GO:0042805 F actinin binding
GO:0043056 P forward locomotion
GO:0043621 F protein self-association
GO:0045214 P sarcomere organization
GO:0045859 P regulation of protein kinase activity
GO:0046872 F metal ion binding
GO:0048739 P cardiac muscle cell development
GO:0048769 P sarcomerogenesis
GO:0050790 P regulation of catalytic activity
GO:0051015 F actin filament binding
GO:0051371 F muscle alpha-actinin binding
GO:0051592 P response to calcium ion
GO:0055002 P striated muscle cell development
GO:0055003 P cardiac myofibril assembly
GO:0055008 P cardiac muscle tissue morphogenesis
GO:0060048 P cardiac muscle contraction
GO:0060419 P heart growth
GO:0070062 C extracellular exosome
GO:0097493 F structural molecule activity conferring elasticity
GO:1901897 P regulation of relaxation of cardiac muscle
Transcript
Level
FPKM:4.15 TPM:4.02
ORF Entry
Sequence
(Nucleotide)
CTCTTCCGATCAGAAAGGTGGTACTATAGGCTTGCAGGTCGAGATAAGAGGAGCGCCAAC
GAGAGTCGAATGGCTACGTGAAGGGCGTCACGTAACAGAGACTTATCGAAATGCTAGAAC
GTTTGTGGAACACGGTCTTTATACTTTAGCTCTTTCTGACGTTAGCGAGAAAGAAACCGG
ACTATACACTTGTAGAGCATGGAATAACCAGGGTAATGTCGATATGAATGCTGCAATAAC
TGTCGTTCAAACTAACGAGCTCGG
(264 bp)

- SilkBase 1999-2023 -