SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_SariASG_c10047_g1_i1
Scaffold_id
NCBI non-redundant
(nr)
Ontology
Transcript
Level
FPKM:3.57 TPM:3.45
ORF Entry
Sequence
(Nucleotide)
CATAGAGGTGCTCGTTGTAATCTCTTTATAGGCCTAAAAGTTATCAACCTCGAGTCACTT
AACATCACGCGAAATTTGTTCTCATTTAACGTAATGAAAGGGAAAACTTACATACATATT
ATTAATGAGTTCATTCGAATTCTTGGGTTTATTGTCAACAAATCGAATTCGAATCGAAAC
TATTGTTTCGAAGTTTCAAAATAAAACAATGTAGGTAGATTATCGGTTTTTAGAATCGGT
AATATGTCGTGGACAAGACCGTCCATTTGTTATTACCCTGGTTTGGGTGAAGCCAAACAC
TCTCTCTCTCTCCCCCTCTCTCTGCCCTCACTCCCCTGTACCCGGTCGTCGCACAAGCCG
ACTGCAATTCAGTTGCATCTGTGAGTTGACAGAAAACTCATTTTAAGTCGTGTGAAACAG
CAAGCAAATCGAATGCAGCGTAAATTACGCGAC
(453 bp)

- SilkBase 1999-2022 -