SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_SariASG_c10019_g1_i1
Scaffold_id
NCBI non-redundant
(nr)
hypothetical_protein_RP20_CCG004375_[Aedes_albopictus]
Ontology
GO:0000166 F nucleotide binding
GO:0003676 F nucleic acid binding
GO:0004190 F aspartic-type endopeptidase activity
GO:0005524 F ATP binding
GO:0006508 P proteolysis
GO:0008233 F peptidase activity
GO:0008270 F zinc ion binding
GO:0015074 P DNA integration
GO:0016787 F hydrolase activity
GO:0046872 F metal ion binding
Transcript
Level
FPKM:2.72 TPM:2.63
ORF Entry
Sequence
(Nucleotide)
GGCCTAGTTAACACTGACAAATACATTAGGGATCGATTGGATCCCGAACGGATAAGTATT
ACTGCAATCTTCATTAGCTTTTTCTAATTTAAGATTTTCTCCATTGGAGTCTCTGAAGTT
TTGCAATTAATCATGTTAAATCTCTTTAAAATATAATTAACATATTGTTCTTGATCTAGA
GTTATACAATCCTTTCTAACATTTATATTCATACCCAG
(218 bp)

- SilkBase 1999-2022 -