SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_ErmoMG_comp37172_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		putative_G_protein-coupled_receptor_[Bombyx_mori]
Ontology
GO:0001934 P positive regulation of protein phosphorylation
GO:0002792 P negative regulation of peptide secretion
GO:0004871 F obsolete signal transducer activity
GO:0004930 F G protein-coupled receptor activity
GO:0004955 F prostaglandin receptor activity
GO:0004957 F prostaglandin E receptor activity
GO:0005886 C plasma membrane
GO:0007165 P signal transduction
GO:0007186 P G protein-coupled receptor signaling pathway
GO:0007188 P adenylate cyclase-modulating G protein-coupled receptor signaling pathway
GO:0007254 P JNK cascade
GO:0007565 P female pregnancy
GO:0008284 P positive regulation of cell population proliferation
GO:0010628 P positive regulation of gene expression
GO:0010727 P negative regulation of hydrogen peroxide metabolic process
GO:0010840 P regulation of circadian sleep/wake cycle, wakefulness
GO:0014070 P response to organic cyclic compound
GO:0014911 P positive regulation of smooth muscle cell migration
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0030819 P obsolete positive regulation of cAMP biosynthetic process
GO:0031965 C nuclear membrane
GO:0032570 P response to progesterone
GO:0032720 P negative regulation of tumor necrosis factor production
GO:0032757 P positive regulation of interleukin-8 production
GO:0033624 P negative regulation of integrin activation
GO:0034695 P response to prostaglandin E
GO:0035810 P positive regulation of urine volume
GO:0035815 P positive regulation of renal sodium excretion
GO:0042093 P T-helper cell differentiation
GO:0042322 P negative regulation of circadian sleep/wake cycle, REM sleep
GO:0042466 P chemokinesis
GO:0042493 P response to xenobiotic stimulus
GO:0042517 P positive regulation of tyrosine phosphorylation of STAT protein
GO:0043025 C neuronal cell body
GO:0043200 P response to amino acid
GO:0044306 C neuron projection terminus
GO:0045669 P positive regulation of osteoblast differentiation
GO:0045778 P positive regulation of ossification
GO:0045780 P positive regulation of bone resorption
GO:0045785 P positive regulation of cell adhesion
GO:0046010 P positive regulation of circadian sleep/wake cycle, non-REM sleep
GO:0050710 P negative regulation of cytokine production
GO:0050712 P negative regulation of interleukin-1 alpha production
GO:0050714 P positive regulation of protein secretion
GO:0050715 P positive regulation of cytokine production
GO:0050728 P negative regulation of inflammatory response
GO:0050729 P positive regulation of inflammatory response
GO:0051492 P regulation of stress fiber assembly
GO:0051771 P negative regulation of nitric-oxide synthase biosynthetic process
GO:0060137 P maternal process involved in parturition
GO:0060348 P bone development
GO:0070257 P positive regulation of mucus secretion
GO:0070371 P ERK1 and ERK2 cascade
GO:0070555 P response to interleukin-1
GO:0071260 P cellular response to mechanical stimulus
GO:0071333 P cellular response to glucose stimulus
GO:0071347 P cellular response to interleukin-1
GO:0071380 P cellular response to prostaglandin E stimulus
GO:0090303 P positive regulation of wound healing
GO:0097070 P ductus arteriosus closure
GO:1900127 P positive regulation of hyaluronan biosynthetic process
GO:1902074 P response to salt
GO:1904336 P negative regulation of ductus arteriosus closure
GO:1904348 P negative regulation of small intestine smooth muscle contraction
GO:1904364 P positive regulation of calcitonin secretion
GO:1904367 P positive regulation of chemokinesis
GO:1904460 P positive regulation of substance P secretion
GO:1904466 P positive regulation of matrix metallopeptidase secretion
GO:1904468 P negative regulation of tumor necrosis factor production
GO:1904471 P negative regulation of endothelin production
GO:1904496 P positive regulation of substance P secretion, neurotransmission
GO:1990785 P response to water-immersion restraint stress
GO:2000386 P positive regulation of ovarian follicle development
GO:2000388 P positive regulation of antral ovarian follicle growth
GO:2000391 P positive regulation of neutrophil extravasation
GO:2000420 P negative regulation of eosinophil extravasation
GO:2001181 P positive regulation of interleukin-10 production
Transcript
Level		FPKM:6.94 TPM:5.11
ORF EntryO_ErmoMG15997_3prime_partial:A_ErmoMG_comp37172_c0_seq1
Sequence
(Nucleotide)
CGCTAGTTAACGTGGAGCGCGGAGTTCAGTGCCGGGAATAATACGTTTGCCGAATTAAAT
AGTTATTGGAATAAAATATAAAGTTGTATGTGCAGTGTCATTATTGTTTTTGATGAACAG
ACGATGCGATCACTAGACACATAAGAAACGATCGAGAAACGAACCACCATGGAGAACATT
ACAAACACCACCCTCACAGAGACTCTCTTCACGAACATCTCACAGTTGAACTCGAGTGAG
AGCAATCCGACGATGGCGTCGAGCCGAGACAACCAGATGTTCCTGTTCGGGATCGTTGTG
AAGGTTGTGTACGCTCTTGGTATCATTGGGAACATCGTGGCGATCATCTCACTGAGGATG
GGAGAGAGGAGAGTCAGGAACAGGAAGTATTTGCTGTTACTGACCTCACTGGCTGCGAAT
GATATCGTTGCTTTGGTCGGCATGATGGGCACGATGGTGATAACGGAACAAATCCCGGGA
GTCAGCTCGAAGCAGTGGCTGTGCATGGCGCGGGTGGTGCTGCGGGTGTTCGGCATCGGC
AGCGTCTGCATCGCCGTCACGATGGCACTCGAGCGGTACCTCGCGCTCACCAGACCCTTC
CTCTATCAAAAGCAAGTGACGTACTACGTGATCCGGATGGCGCTACTGCTGTCGTGGTTC
TTCGCGGCGCTGCTGACCTGCGCCCCCATGCTCGGACTAGGCCTGTACTACGACGCGGAG
AACGGCAAGTGTCTCCGGTACAGGGAGGCCGTCTCACCCACTGACTTCGCATACGCTGTC
ATCTAC
(786 bp)

- SilkBase 1999-2023 -