SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/04/21
 
NameA_ErmoMG_comp35300_c1_seq1
Scaffold_id
NCBI non-redundant
(nr)
PREDICTED:_cytosolic_10-formyltetrahydrofolate_dehydrogenase_[Bombyx_mori]
Ontology
GO:0003824 F catalytic activity
GO:0005737 C cytoplasm
GO:0006730 P one-carbon metabolic process
GO:0008152 P metabolic process
GO:0009058 P biosynthetic process
GO:0009258 P 10-formyltetrahydrofolate catabolic process
GO:0016155 F formyltetrahydrofolate dehydrogenase activity
GO:0016491 F oxidoreductase activity
GO:0016620 F oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor
GO:0016742 F hydroxymethyl-, formyl- and related transferase activity
GO:0055114 P obsolete oxidation-reduction process
Transcript
Level
FPKM:1.61 TPM:1.19
ORF EntryO_ErmoMG10030_internal:A_ErmoMG_comp35300_c1_seq1
Sequence
(Nucleotide)
CGTGAATGCTGATAGCGGTAAAGTTTTAACTTTGATTAACCCAACGGACGAGAGTGTGAT
CTGTAAAGTGCAGAGCGCGTCCCCCAACGACGTGGACAAGGCCGTGAAAGCCGCTAAGAA
GGCATTCGATGAAGGAGAATGGGCTAAAATCAGCGCCCGAGAAAGAGGACAGATGTTATT
CAAACTAGCAGATTTGATGGAACAACATAAAGAAGAACTGGCCACAATCGAATCCATAGA
CTCCGGAGCTGTCTACACACTAGCTCTCAAGACACACGTGGGTATGTCCATAGACACGTG
GCGCTACTTCGCCGGTTGGTGCGACAAGATCCAAGGCACAACTGTACCTATAAACCACGC
CAGACCGAACAG
(372 bp)

- SilkBase 1999-2022 -