SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_ErmoMG_comp17383_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_uncharacterized_protein_LOC101739897_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0000781 C chromosome, telomeric region
GO:0003677 F DNA binding
GO:0004386 F helicase activity
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005694 C chromosome
GO:0006281 P DNA repair
GO:0006334 P nucleosome assembly
GO:0006336 P DNA replication-independent chromatin assembly
GO:0006338 P chromatin remodeling
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0006974 P cellular response to DNA damage stimulus
GO:0010571 P positive regulation of nuclear cell cycle DNA replication
GO:0016568 P chromatin organization
GO:0016605 C PML body
GO:0016787 F hydrolase activity
GO:0030330 P DNA damage response, signal transduction by p53 class mediator
GO:0031297 P replication fork processing
GO:0031933 C obsolete telomeric heterochromatin
GO:0032206 P positive regulation of telomere maintenance
GO:0042393 F histone binding
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0046872 F metal ion binding
GO:0070603 C SWI/SNF superfamily-type complex
GO:0072711 P cellular response to hydroxyurea
GO:1901581 P negative regulation of telomeric RNA transcription from RNA pol II promoter
Transcript
Level		FPKM:2.84 TPM:2.09
ORF Entry
Sequence
(Nucleotide)
AATATGCTTTGTATATCGTGAGCTGGGTTCCATGAGGTATCCAATATTATAACTCTGTTA
GCTGCCGTCATATTCAACCCTAATGAACCAGCTCGGGTTGATATCAGGAATAGTTTAGTT
TTAATGTTGTTCTCAGCGTTGAACTCTCTGCACCACTTCTGGCGAACCTCGGGAGGCACG
GAGCCATCGAGACGATAGTAGTCGTGGCCGAGACTCCAG
(219 bp)

- SilkBase 1999-2023 -