SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoSK_comp10336_c0_seq2
Scaffold_idBomo_Chr1
NCBI non-redundant
(nr)		PREDICTED:_epidermal_growth_factor_receptor_isoform_X1_[Papilio_xuthus]
Ontology
GO:0000086 P G2/M transition of mitotic cell cycle
GO:0000166 F nucleotide binding
GO:0000578 P embryonic axis specification
GO:0001654 P eye development
GO:0001709 P cell fate determination
GO:0001742 P oenocyte differentiation
GO:0001745 P compound eye morphogenesis
GO:0001751 P compound eye photoreceptor cell differentiation
GO:0001752 P compound eye photoreceptor fate commitment
GO:0002009 P morphogenesis of an epithelium
GO:0003015 P heart process
GO:0004672 F protein kinase activity
GO:0004713 F protein tyrosine kinase activity
GO:0004714 F transmembrane receptor protein tyrosine kinase activity
GO:0004888 F transmembrane signaling receptor activity
GO:0005006 F epidermal growth factor-activated receptor activity
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005886 C plasma membrane
GO:0005887 C integral component of plasma membrane
GO:0006468 P protein phosphorylation
GO:0007169 P transmembrane receptor protein tyrosine kinase signaling pathway
GO:0007173 P epidermal growth factor receptor signaling pathway
GO:0007275 P multicellular organism development
GO:0007298 P border follicle cell migration
GO:0007309 P oocyte axis specification
GO:0007310 P oocyte dorsal/ventral axis specification
GO:0007314 P oocyte anterior/posterior axis specification
GO:0007346 P regulation of mitotic cell cycle
GO:0007350 P blastoderm segmentation
GO:0007367 P segment polarity determination
GO:0007369 P gastrulation
GO:0007390 P germ-band shortening
GO:0007391 P dorsal closure
GO:0007420 P brain development
GO:0007421 P stomatogastric nervous system development
GO:0007422 P peripheral nervous system development
GO:0007424 P open tracheal system development
GO:0007431 P salivary gland development
GO:0007443 P Malpighian tubule morphogenesis
GO:0007444 P imaginal disc development
GO:0007447 P imaginal disc pattern formation
GO:0007455 P eye-antennal disc morphogenesis
GO:0007458 P progression of morphogenetic furrow involved in compound eye morphogenesis
GO:0007469 P antennal development
GO:0007472 P wing disc morphogenesis
GO:0007473 P wing disc proximal/distal pattern formation
GO:0007474 P imaginal disc-derived wing vein specification
GO:0007476 P imaginal disc-derived wing morphogenesis
GO:0007477 P notum development
GO:0007479 P leg disc proximal/distal pattern formation
GO:0007482 P haltere development
GO:0008071 P maternal determination of dorsal/ventral axis, ovarian follicular epithelium, soma encoded
GO:0008284 P positive regulation of cell population proliferation
GO:0008313 F gurken-activated receptor activity
GO:0008314 P gurken signaling pathway
GO:0008340 P determination of adult lifespan
GO:0008355 P olfactory learning
GO:0008406 P gonad development
GO:0008586 P imaginal disc-derived wing vein morphogenesis
GO:0009792 P embryo development ending in birth or egg hatching
GO:0009880 P embryonic pattern specification
GO:0009950 P dorsal/ventral axis specification
GO:0009952 P anterior/posterior pattern specification
GO:0009953 P dorsal/ventral pattern formation
GO:0010906 P regulation of glucose metabolic process
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016203 P muscle attachment
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016318 P ommatidial rotation
GO:0016330 P second mitotic wave involved in compound eye morphogenesis
GO:0016333 P morphogenesis of follicular epithelium
GO:0016337 P cell-cell adhesion
GO:0016740 F transferase activity
GO:0018108 P peptidyl-tyrosine phosphorylation
GO:0022008 P neurogenesis
GO:0030031 P cell projection assembly
GO:0030381 P chorion-containing eggshell pattern formation
GO:0030718 P germ-line stem cell population maintenance
GO:0035088 P establishment or maintenance of apical/basal cell polarity
GO:0035160 P maintenance of epithelial integrity, open tracheal system
GO:0035202 P tracheal pit formation in open tracheal system
GO:0035225 P determination of genital disc primordium
GO:0035230 C cytoneme
GO:0035277 P spiracle morphogenesis, open tracheal system
GO:0035309 P wing and notum subfield formation
GO:0035310 P notum cell fate specification
GO:0042676 P compound eye cone cell fate commitment
GO:0042694 P muscle cell fate specification
GO:0043066 P negative regulation of apoptotic process
GO:0045165 P cell fate commitment
GO:0045466 P R7 cell differentiation
GO:0045468 P regulation of R8 cell spacing in compound eye
GO:0045610 P regulation of hemocyte differentiation
GO:0046673 P negative regulation of compound eye retinal cell programmed cell death
GO:0046843 P dorsal appendage formation
GO:0046845 P branched duct epithelial cell fate determination, open tracheal system
GO:0048139 P female germ-line cyst encapsulation
GO:0048140 P male germ-line cyst encapsulation
GO:0048149 P behavioral response to ethanol
GO:0048477 P oogenesis
GO:0048546 P digestive tract morphogenesis
GO:0048749 P compound eye development
GO:0048865 P stem cell fate commitment
GO:0061331 P epithelial cell proliferation involved in Malpighian tubule morphogenesis
GO:0090303 P positive regulation of wound healing
GO:2000134 P negative regulation of G1/S transition of mitotic cell cycle
GO:2001234 P negative regulation of apoptotic signaling pathway
Transcript
Level		FPKM:3.25 TPM:3.27
ORF Entry
Sequence
(Nucleotide)
CCGGGCGCTCGTGTCTGAGGCAGCTTCGCGAGTGATGTCGCAGCATGGTCGCTGCTCGTG
CCTTGTTGTGGTGCCTGTGCCTTGCCGCTTTCGGGACGGTGGACGCCGCCAAACACCGCA
ACCACCATCCCGTCAACTCAAGACATAAACATTCGGAATTCGTTAAAGGAAAAATATGCA
TCGGAACGAACGGTCGAATGTCAGTCCCGTCGAATCGCGACACCCACTACCGGAATCTTC
GCGATCGCTTCA
(252 bp)

- SilkBase 1999-2023 -