SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoOtmSK_comp1041635_c0_seq1
Scaffold_idBomo_Chr6
NCBI non-redundant
(nr)		lysosome_membrane_protein_2-like_[Bombyx_mori]
Ontology
GO:0005794 C Golgi apparatus
GO:0005886 C plasma membrane
GO:0006810 P transport
GO:0006955 P immune response
GO:0007155 P cell adhesion
GO:0007166 P cell surface receptor signaling pathway
GO:0007204 P positive regulation of cytosolic calcium ion concentration
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016324 C apical plasma membrane
GO:0030299 P intestinal cholesterol absorption
GO:0031526 C brush border membrane
GO:0031623 P receptor internalization
GO:0033993 P response to lipid
GO:0034197 P triglyceride transport
GO:0044539 P long-chain fatty acid import into cell
GO:0045121 C membrane raft
GO:0050702 P interleukin-1 beta production
GO:0050892 P intestinal absorption
GO:0050909 P sensory perception of taste
GO:0070374 P positive regulation of ERK1 and ERK2 cascade
GO:0070508 P cholesterol import
GO:0070542 P response to fatty acid
GO:0070543 P response to linoleic acid
GO:0071404 P cellular response to low-density lipoprotein particle stimulus
GO:0071726 P cellular response to diacyl bacterial lipopeptide
GO:1900227 P positive regulation of NLRP3 inflammasome complex assembly
GO:1990000 P amyloid fibril formation
GO:2000505 P energy homeostasis
Transcript
Level		FPKM:1.25 TPM:1.34
ORF Entry
Sequence
(Nucleotide)
GGATTATCAAAGGGGCATTTATTGGATGCTGATCCAAAACTGTTCGATCGCATCAAGGGC
TTGAAGCCAGATCCCGAAAAACATTCTAGTCACTTAGTCATAGAACCGAAAATTGGATTG
ACTCTAGAAACGTCATGGTCACTACAAGCAAACATCTTTGTTGGAGATATAACATACAAC
GCTGACGCTAAGATGTTTTCCATTAT
(206 bp)

- SilkBase 1999-2023 -