SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoOtmSK_comp1040600_c0_seq1
Scaffold_idBomo_Chr1
NCBI non-redundant
(nr)		ionotropic_GABA-aminobutyric_acid_receptor_RDL1-3b6a_[Bombyx_mori]
Ontology
GO:0002121 P inter-male aggressive behavior
GO:0004890 F GABA-A receptor activity
GO:0005216 F ion channel activity
GO:0005230 F extracellular ligand-gated ion channel activity
GO:0005254 F chloride channel activity
GO:0005886 C plasma membrane
GO:0006810 P transport
GO:0006811 P ion transport
GO:0006821 P chloride transport
GO:0007165 P signal transduction
GO:0007268 P chemical synaptic transmission
GO:0009612 P response to mechanical stimulus
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016917 F GABA receptor activity
GO:0030054 C cell junction
GO:0030424 C axon
GO:0030425 C dendrite
GO:0030431 P sleep
GO:0030594 F neurotransmitter receptor activity
GO:0034220 P ion transmembrane transport
GO:0034707 C chloride channel complex
GO:0042493 P response to xenobiotic stimulus
GO:0042749 P regulation of circadian sleep/wake cycle
GO:0045202 C synapse
GO:0045211 C postsynaptic membrane
GO:0046682 P response to cyclodiene
GO:0050805 P negative regulation of synaptic transmission
GO:0090328 P regulation of olfactory learning
GO:0099565 P chemical synaptic transmission, postsynaptic
GO:1902476 P chloride transmembrane transport
Transcript
Level		FPKM:2.34 TPM:2.52
ORF Entry
Sequence
(Nucleotide)
GTGAACTTTAAAACGGACTTCAGATGGTCTGCTAGGAGGACATCTGCTTAAAGTATTCAT
CTTCGATAAAGTGTGTGGATCGCCGACTGGAGGGCATTCTGGAAGTTTCTTCTCCGAGGC
AATTTTCTGTATAGCCACAAATCGCTGTTTCCTCATTTGTATTCTCTTAGCCATATATCC
GACAGTTGCGTATTCTAAAAGACTCGCGA
(209 bp)

- SilkBase 1999-2023 -