SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoOtmSK_comp10245_c0_seq1
Scaffold_idBomo_Chr25
NCBI non-redundant
(nr)		protein_serrate_precursor_[Bombyx_mori]
Ontology
GO:0005102 F signaling receptor binding
GO:0005112 F Notch binding
GO:0005509 F calcium ion binding
GO:0005515 F protein binding
GO:0005886 C plasma membrane
GO:0005887 C integral component of plasma membrane
GO:0007154 P cell communication
GO:0007219 P Notch signaling pathway
GO:0007275 P multicellular organism development
GO:0007423 P sensory organ development
GO:0007431 P salivary gland development
GO:0007435 P salivary gland morphogenesis
GO:0007436 P larval salivary gland morphogenesis
GO:0007451 P dorsal/ventral lineage restriction, imaginal disc
GO:0007476 P imaginal disc-derived wing morphogenesis
GO:0009986 C cell surface
GO:0014009 P glial cell proliferation
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016324 C apical plasma membrane
GO:0016330 P second mitotic wave involved in compound eye morphogenesis
GO:0030154 P cell differentiation
GO:0030673 C axolemma
GO:0030718 P germ-line stem cell population maintenance
GO:0035017 P cuticle pattern formation
GO:0035167 P larval lymph gland hemopoiesis
GO:0035170 P lymph gland crystal cell differentiation
GO:0035214 P eye-antennal disc development
GO:0036011 P imaginal disc-derived leg segmentation
GO:0042688 P crystal cell differentiation
GO:0042689 P regulation of crystal cell differentiation
GO:0045746 P negative regulation of Notch signaling pathway
GO:0046331 P lateral inhibition
GO:0048749 P compound eye development
Transcript
Level		FPKM:5.19 TPM:5.59
ORF EntryO_BomoOtmSK5295_internal:A_BomoOtmSK_comp10245_c0_seq1
Sequence
(Nucleotide)
CGGGCGGATGCTGCGGGGGCGGCGGTCCGAGGGGCGCGGGAGCGGCGGCCTGCTCGCATC
CTTGCCGCACCAGGTTTACGCTCTGCCTCAAGGAGTACCAGTCGGCGGCTGCGCCCGGCG
GGAGCTGCTCCTTCGGGCGCGCCGCCTCCCCCGTCCTTGGCACTGACTCCTTCACTCTGG
CTGAGCCTCTCTACACCCTCGCACTGCCCTTCAGCTTCCGATGGACGCGTTCGTTCACGT
TGATCCTGCAGGCGTATGACGACTACGAATACTCCGAGCCCGAAGCGGGGCTCATCGAGG
AGGCGTGGTGGTCCGGGATCGTGGAGCCGAG
(331 bp)

- SilkBase 1999-2023 -