SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoN4EE_TR10366_c0_g1_i1
Scaffold_idBomo_Chr14
NCBI non-redundant
(nr)		PREDICTED:_transient_receptor_potential_protein_isoform_X2_[Bombyx_mori]
Ontology
GO:0005216 F ion channel activity
GO:0005262 F calcium channel activity
GO:0005515 F protein binding
GO:0005516 F calmodulin binding
GO:0005622 C intracellular anatomical structure
GO:0005886 C plasma membrane
GO:0005887 C integral component of plasma membrane
GO:0006810 P transport
GO:0006811 P ion transport
GO:0006816 P calcium ion transport
GO:0006828 P manganese ion transport
GO:0007601 P visual perception
GO:0007603 P phototransduction, visible light
GO:0007605 P sensory perception of sound
GO:0007608 P sensory perception of smell
GO:0008104 P protein localization
GO:0008355 P olfactory learning
GO:0008377 P light-induced release of internally sequestered calcium ion
GO:0009416 P response to light stimulus
GO:0010461 F light-activated ion channel activity
GO:0015278 F calcium-release channel activity
GO:0015279 F store-operated calcium channel activity
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016027 C inaD signaling complex
GO:0016028 C rhabdomere
GO:0019722 P calcium-mediated signaling
GO:0030845 P phospholipase C-inhibiting G protein-coupled receptor signaling pathway
GO:0034703 C cation channel complex
GO:0035997 C rhabdomere microvillus membrane
GO:0042802 F identical protein binding
GO:0042803 F protein homodimerization activity
GO:0046982 F protein heterodimerization activity
GO:0050896 P response to stimulus
GO:0050908 P detection of light stimulus involved in visual perception
GO:0050962 P detection of light stimulus involved in sensory perception
GO:0051209 P release of sequestered calcium ion into cytosol
GO:0051480 P regulation of cytosolic calcium ion concentration
GO:0055085 P transmembrane transport
GO:0070588 P calcium ion transmembrane transport
GO:0071454 P cellular response to anoxia
Transcript
Level		FPKM:0.00 TPM:0.00
ORF EntryO_BomoN4EE857_internal:A_BomoN4EE_TR10366_c0_g1_i1
Sequence
(Nucleotide)
ACCAGAACCTCAAAGGAGTTAGAGATTATGCTCAACTACAACCCATGGGATTTGGACTGC
TGGGAGCCCGGGGAAAGGCAAACACTTGGACGTCTCAAATTGGCCATCAAATACAAGCAA
AAAATGTTTGTAGCACATCCTAATGTGCAGCAGTTATTGGGAGCAATCTGGTATGAAGGA
CTGCCGGGCTTCAAAAGGAAAAATATTTTCGGTCAATGCGTTCAGGTAGCAAAATTGGGA
GTGATGTTTCCTGTTTACTGCACAATATACATGTTGGCCCCAAACTCAGAGTACGGCAGG
TTCATGAAAAAACCATTCGTCAAGTTTATTTGTCACAGTA
(340 bp)

- SilkBase 1999-2023 -