SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoN4EE_TR101807_c0_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		cytochrome_b,_partial_(mitochondrion)_[Homo_sapiens]
Ontology
GO:0001666 P response to hypoxia
GO:0005739 C mitochondrion
GO:0005743 C mitochondrial inner membrane
GO:0005750 C mitochondrial respiratory chain complex III
GO:0006122 P mitochondrial electron transport, ubiquinol to cytochrome c
GO:0007584 P response to nutrient
GO:0008121 F ubiquinol-cytochrome-c reductase activity
GO:0009055 F electron transfer activity
GO:0009408 P response to heat
GO:0009636 P response to toxic substance
GO:0009725 P response to hormone
GO:0010243 P response to organonitrogen compound
GO:0014070 P response to organic cyclic compound
GO:0015992 P proton transmembrane transport
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016491 F oxidoreductase activity
GO:0022904 P respiratory electron transport chain
GO:0031100 P animal organ regeneration
GO:0032403 F protein-containing complex binding
GO:0033590 P response to cobalamin
GO:0033762 P response to glucagon
GO:0042493 P response to xenobiotic stimulus
GO:0042538 P hyperosmotic salinity response
GO:0043234 C protein-containing complex
GO:0045275 C respiratory chain complex III
GO:0045471 P response to ethanol
GO:0046686 P response to cadmium ion
GO:0046688 P response to copper ion
GO:0046689 P response to mercury ion
GO:0046872 F metal ion binding
GO:0051592 P response to calcium ion
GO:0055093 P response to hyperoxia
GO:0055114 P obsolete oxidation-reduction process
GO:0070469 C respirasome
GO:1902600 P proton transmembrane transport
Transcript
Level		FPKM:0.00 TPM:0.00
ORF Entry
Sequence
(Nucleotide)
ACCCTAGCCAACCCCTTAAATACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTC
GCCTACACAATTCTCCGATCCGTCCCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTA
TCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATGTCCAAACAACAAAGCATAATA
TTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGA
(224 bp)

- SilkBase 1999-2023 -