SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoMSG_c26094_g1_i2
Scaffold_idBomo_Chr26
NCBI non-redundant
(nr)		general_transcription_factor_IIH_subunit_3_[Bombyx_mori]
Ontology
GO:0000439 C transcription factor TFIIH core complex
GO:0000717 P nucleotide-excision repair, DNA duplex unwinding
GO:0003684 F damaged DNA binding
GO:0003700 F DNA-binding transcription factor activity
GO:0004672 F protein kinase activity
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005654 C nucleoplasm
GO:0005675 C transcription factor TFIIH holo complex
GO:0006281 P DNA repair
GO:0006283 P transcription-coupled nucleotide-excision repair
GO:0006289 P nucleotide-excision repair
GO:0006293 P nucleotide-excision repair, preincision complex stabilization
GO:0006294 P nucleotide-excision repair, preincision complex assembly
GO:0006295 P nucleotide-excision repair, DNA incision, 3'-to lesion
GO:0006296 P nucleotide-excision repair, DNA incision, 5'-to lesion
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0006361 P transcription initiation from RNA polymerase I promoter
GO:0006362 P transcription elongation from RNA polymerase I promoter
GO:0006363 P termination of RNA polymerase I transcription
GO:0006366 P transcription by RNA polymerase II
GO:0006367 P transcription initiation from RNA polymerase II promoter
GO:0006368 P transcription elongation from RNA polymerase II promoter
GO:0006370 P 7-methylguanosine mRNA capping
GO:0006412 P translation
GO:0006974 P cellular response to DNA damage stimulus
GO:0008094 F ATP-dependent activity, acting on DNA
GO:0008135 F translation factor activity, RNA binding
GO:0008353 F RNA polymerase II CTD heptapeptide repeat kinase activity
GO:0033683 P nucleotide-excision repair, DNA incision
GO:0046872 F metal ion binding
GO:0047485 F protein N-terminus binding
GO:0070816 P phosphorylation of RNA polymerase II C-terminal domain
GO:0070911 P global genome nucleotide-excision repair
Transcript
Level		FPKM:4.15 TPM:2.16
ORF EntryO_BomoMSG18304_5prime_partial:A_BomoMSG_c26094_g1_i2
Sequence
(Nucleotide)
GACAGGGTTGCGACATCACGGCAACAGGGTTGCGACATCACGGGCGGCCTGTACCTGAAG
ATACCGAGCTTGGAGGGCTTGCTGCAGTACTTACTGTGGGTTTTCCTGCCGGAAGCCAAT
GAGAGAAGTAAACTGGTACTGCCGGGGCGGGGCCGCGTGGACTACCGCGCTGCCTGCTTC
TGCCACAGGGAACTGCTCACCATCGGCTACGTCTGCTCGGTTTGCTTGAGTGTTTTCTGC
AAATTCAGCCCGATATGTACAACGTGTCACACCGTCTTCAAAATAGGAGGACCACCTATC
AAACCCAAGAAGAAGAAAATGAAAGTTTAAATTGACTTTTACCTGCTCTTAATATTCGTG
AGCCCTTAATACTAATGTGTCCATACTGTGAAAATGAACCGGCAGATCGGAAGAGCGTCG
(420 bp)

- SilkBase 1999-2023 -