SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoMSG_c25861_g2_i9
Scaffold_idBomo_Chr18
NCBI non-redundant
(nr)		unknown_[Bombyx_mori]
Ontology
GO:0000165 P MAPK cascade
GO:0000166 F nucleotide binding
GO:0001505 P regulation of neurotransmitter levels
GO:0001933 P negative regulation of protein phosphorylation
GO:0002026 P regulation of the force of heart contraction
GO:0004867 F serine-type endopeptidase inhibitor activity
GO:0005102 F signaling receptor binding
GO:0005524 F ATP binding
GO:0005615 C extracellular space
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005739 C mitochondrion
GO:0005741 C mitochondrial outer membrane
GO:0005791 C rough endoplasmic reticulum
GO:0005794 C Golgi apparatus
GO:0006979 P response to oxidative stress
GO:0007286 P spermatid development
GO:0007568 P aging
GO:0008021 C synaptic vesicle
GO:0008289 F lipid binding
GO:0009408 P response to heat
GO:0009611 P response to wounding
GO:0009636 P response to toxic substance
GO:0009986 C cell surface
GO:0010033 P response to organic substance
GO:0010243 P response to organonitrogen compound
GO:0010466 P negative regulation of peptidase activity
GO:0010951 P negative regulation of endopeptidase activity
GO:0014070 P response to organic cyclic compound
GO:0014823 P response to activity
GO:0019899 F enzyme binding
GO:0019900 F kinase binding
GO:0019901 F protein kinase binding
GO:0021766 P hippocampus development
GO:0030414 F peptidase inhibitor activity
GO:0042493 P response to xenobiotic stimulus
GO:0042755 P eating behavior
GO:0043005 C neuron projection
GO:0043025 C neuronal cell body
GO:0043209 C myelin sheath
GO:0043409 P negative regulation of MAPK cascade
GO:0043679 C axon terminus
GO:0043950 P positive regulation of cAMP-mediated signaling
GO:0044822 F RNA binding
GO:0045177 C apical part of cell
GO:0045471 P response to ethanol
GO:0045840 P positive regulation of mitotic nuclear division
GO:0048240 P sperm capacitation
GO:0051019 F mitogen-activated protein kinase binding
GO:0051412 P response to corticosterone
GO:0051591 P response to cAMP
GO:0051592 P response to calcium ion
GO:0051602 P response to electrical stimulus
GO:0060409 P positive regulation of acetylcholine metabolic process
GO:0070062 C extracellular exosome
Transcript
Level		FPKM:59.68 TPM:31.05
ORF EntryO_BomoMSG17552_5prime_partial:A_BomoMSG_c25861_g2_i9
Sequence
(Nucleotide)
ATTTCAAAATTGCCGAGTTCGCCAAGAAGTACAACCTAGGGGATCCGATTGCGGGCAACT
TCTACGAAGCGCAGTATGACGACTACGTCCCTATTCTGTACAAGCAGCTCGGTGCTTAAA
TACGCATTTTTATGTGTCGATACGATACGACAGGGACTCTTACTAAAATCCTTTATAGTA
CTTTCTAGGATAGCTGTTTTCAAAGATTCAATAGACCAAGGGAACGTTTATATACTTTCT
TATCTATTTATATAAAAATGAATTGCTGTTCGTTAGTCTCGCTAAAACTCGAGAACGGCT
GGACCGATTTGGCTAATTTTGGTCTTGAATTATTTGTGGAAGTCCAGAGAAGGTTTAAAA
TGTAGATAAATATGAAAATGCTCGGAATTAAATAAAAACAATAATTTTGTTTTTCTTTTG
ATGTGTCCCCCGTCGGACGGATTCCTTTTGTTTGTTTTAAGTTTATTTTATACAAAAGTT
TAGGTCTTTTATTTATCGATTGAGGCACTACGAAGTCTGCCGGGTCAGCTAGTTTAAAAT
AAATTCTGATTTTAGATTCGATTACAAAGCTACTTATTTCACGGAGATCGGAAGAGCGTC
G
(601 bp)

- SilkBase 1999-2023 -