SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoMSG_c13941_g1_i1
Scaffold_idBomo_Chr9
NCBI non-redundant
(nr)		coronin-2B_isoform_X2_[Bombyx_mori]
Ontology
GO:0001772 C immunological synapse
GO:0001845 P phagolysosome assembly
GO:0001891 C phagocytic cup
GO:0003674 F molecular_function
GO:0003779 F actin binding
GO:0003785 F actin monomer binding
GO:0005575 C cellular_component
GO:0005737 C cytoplasm
GO:0005769 C early endosome
GO:0005829 C cytosol
GO:0005856 C cytoskeleton
GO:0005884 C actin filament
GO:0005886 C plasma membrane
GO:0005911 C cell-cell junction
GO:0005938 C cell cortex
GO:0006816 P calcium ion transport
GO:0006909 P phagocytosis
GO:0007015 P actin filament organization
GO:0008022 F protein C-terminus binding
GO:0008064 P regulation of actin polymerization or depolymerization
GO:0008092 F cytoskeletal protein binding
GO:0008150 P biological_process
GO:0008360 P regulation of cell shape
GO:0015629 C actin cytoskeleton
GO:0016020 C membrane
GO:0016477 P cell migration
GO:0030027 C lamellipodium
GO:0030036 P actin cytoskeleton organization
GO:0030217 P T cell differentiation
GO:0030335 P positive regulation of cell migration
GO:0030424 C axon
GO:0030595 P leukocyte chemotaxis
GO:0030670 C phagocytic vesicle membrane
GO:0030833 P regulation of actin filament polymerization
GO:0030864 C cortical actin cytoskeleton
GO:0031252 C cell leading edge
GO:0031339 P negative regulation of vesicle fusion
GO:0031410 C cytoplasmic vesicle
GO:0031589 P cell-substrate adhesion
GO:0032036 F myosin heavy chain binding
GO:0032796 P uropod organization
GO:0032956 P regulation of actin cytoskeleton organization
GO:0034097 P response to cytokine
GO:0038180 P nerve growth factor signaling pathway
GO:0042102 P positive regulation of T cell proliferation
GO:0042802 F identical protein binding
GO:0042803 F protein homodimerization activity
GO:0043029 P T cell homeostasis
GO:0043234 C protein-containing complex
GO:0043320 P natural killer cell degranulation
GO:0043524 P negative regulation of neuron apoptotic process
GO:0043548 F phosphatidylinositol 3-kinase binding
GO:0044822 F RNA binding
GO:0045335 C phagocytic vesicle
GO:0048873 P homeostasis of number of cells within a tissue
GO:0050870 P positive regulation of T cell activation
GO:0050918 P positive chemotaxis
GO:0051015 F actin filament binding
GO:0051126 P negative regulation of actin nucleation
GO:0051279 P regulation of release of sequestered calcium ion into cytosol
GO:0061502 P early endosome to recycling endosome transport
GO:0070062 C extracellular exosome
GO:0071353 P cellular response to interleukin-4
Transcript
Level		FPKM:1.43 TPM:0.75
ORF Entry
Sequence
(Nucleotide)
CGGCCGCCCCCCTGCCCTCGTTGACTGCGAAGGACTGGTTGAGCGGAATGAACGCACCTC
CGCTCCTAATCAGTATGAAAACAGGAGTGACGATATCGACGCACAAGCCGAGCACGGGCA
ACAAGGACGCCCCCGCGCTGCAACCTCAGGACGTGAACAACAGAAAGAAGTTTATGTTCC
TCTCGCGCGAAACCACACCCGACTACCGCCCTCTCAACGCCTGCCCGAACGCACTCAATC
ACAACAATGAGAATGAGATACAAGTGAACGAGAAA
(275 bp)

- SilkBase 1999-2023 -