SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoMSG_c13604_g1_i2
Scaffold_idBomo_Chr18
NCBI non-redundant
(nr)		zinc_finger_protein_OZF_[Bombyx_mori]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0000977 F RNA polymerase II transcription regulatory region sequence-specific DNA binding
GO:0001078 F DNA-binding transcription repressor activity, RNA polymerase II-specific
GO:0001227 F DNA-binding transcription repressor activity, RNA polymerase II-specific
GO:0001649 P osteoblast differentiation
GO:0001707 P mesoderm formation
GO:0001837 P epithelial to mesenchymal transition
GO:0003198 P epithelial to mesenchymal transition involved in endocardial cushion formation
GO:0003676 F nucleic acid binding
GO:0003677 F DNA binding
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0006357 P regulation of transcription by RNA polymerase II
GO:0007275 P multicellular organism development
GO:0007498 P mesoderm development
GO:0010718 P positive regulation of epithelial to mesenchymal transition
GO:0010957 P negative regulation of vitamin D biosynthetic process
GO:0016477 P cell migration
GO:0019900 F kinase binding
GO:0030335 P positive regulation of cell migration
GO:0031069 P hair follicle morphogenesis
GO:0043518 P negative regulation of DNA damage response, signal transduction by p53 class mediator
GO:0043565 F sequence-specific DNA binding
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0046872 F metal ion binding
GO:0060021 P roof of mouth development
GO:0060536 P cartilage morphogenesis
GO:0060707 P trophoblast giant cell differentiation
GO:0060806 P negative regulation of cell differentiation involved in embryonic placenta development
GO:0060972 P left/right pattern formation
GO:0061314 P Notch signaling involved in heart development
GO:1902230 P negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage
GO:2000810 P regulation of bicellular tight junction assembly
Transcript
Level		FPKM:1.22 TPM:0.63
ORF Entry
Sequence
(Nucleotide)
TGCTCTTCCGATCTGATAAATATCGTTGTACAGTTGGAGAATGTAATAAAGCATTTCCCA
TGATGAAGTTGCTCGAGACTCATTTGTATAAATATCATACAGACACCATGCCGTTTATGT
GCAGTCACTGTCCAAGAAGGTTTTATCGTAGGTCAGATTTGACAAGACACCTTAAAGGTA
GTCATTTAGACAGTGACAAACTCAAAGTAAAACCAGAGCTAATATTAACTATAGTGAATA
TCTAATTTTTAATCATAAATATATTTATGTATTACTAAGTACATACCTGC
(290 bp)

- SilkBase 1999-2023 -