SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoMSG_c12500_g1_i1
Scaffold_idBomo_Chr7
NCBI non-redundant
(nr)		PREDICTED:_dystrophin,_isoforms_A/C/F/G/H-like_[Amyelois_transitella]
Ontology
GO:0001954 P positive regulation of cell-matrix adhesion
GO:0002027 P regulation of heart rate
GO:0002162 F dystroglycan binding
GO:0003779 F actin binding
GO:0005200 F structural constituent of cytoskeleton
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005856 C cytoskeleton
GO:0005886 C plasma membrane
GO:0006355 P regulation of transcription, DNA-templated
GO:0007517 P muscle organ development
GO:0007519 P skeletal muscle tissue development
GO:0008065 P establishment of blood-nerve barrier
GO:0008270 F zinc ion binding
GO:0008307 F structural constituent of muscle
GO:0009986 C cell surface
GO:0010468 P regulation of gene expression
GO:0010880 P regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum
GO:0010881 P regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion
GO:0010976 P positive regulation of neuron projection development
GO:0014809 P regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion
GO:0014819 P regulation of skeletal muscle contraction
GO:0014904 P myotube cell development
GO:0016010 C dystrophin-associated glycoprotein complex
GO:0016020 C membrane
GO:0016203 P muscle attachment
GO:0017022 F myosin binding
GO:0017166 F vinculin binding
GO:0021629 P olfactory nerve structural organization
GO:0030018 C Z disc
GO:0030054 C cell junction
GO:0030055 C cell-substrate junction
GO:0030175 C filopodium
GO:0031527 C filopodium membrane
GO:0033137 P negative regulation of peptidyl-serine phosphorylation
GO:0034613 P cellular protein localization
GO:0035994 P response to muscle stretch
GO:0042383 C sarcolemma
GO:0042391 P regulation of membrane potential
GO:0043034 C costamere
GO:0043043 P peptide biosynthetic process
GO:0043234 C protein-containing complex
GO:0043623 P protein-containing complex assembly
GO:0044306 C neuron projection terminus
GO:0045121 C membrane raft
GO:0045202 C synapse
GO:0045211 C postsynaptic membrane
GO:0045213 P neurotransmitter receptor metabolic process
GO:0045666 P positive regulation of neuron differentiation
GO:0046716 P muscle cell cellular homeostasis
GO:0046872 F metal ion binding
GO:0048747 P muscle cell development
GO:0050998 F nitric-oxide synthase binding
GO:0051647 P nucleus localization
GO:0060048 P cardiac muscle contraction
GO:0060314 P regulation of ryanodine-sensitive calcium-release channel activity
GO:0060857 P establishment of glial blood-brain barrier
GO:0070373 P negative regulation of ERK1 and ERK2 cascade
GO:0086001 P cardiac muscle cell action potential
GO:0090287 P regulation of cellular response to growth factor stimulus
GO:1901385 P regulation of voltage-gated calcium channel activity
GO:1902083 P negative regulation of peptidyl-cysteine S-nitrosylation
GO:2000651 P positive regulation of sodium ion transmembrane transporter activity
Transcript
Level		FPKM:2.05 TPM:1.07
ORF Entry
Sequence
(Nucleotide)
ATGCGCGTGCACCACATCAACAACGTGAACACGGCGCTGCGCGTGCTCGACGAGCACGGC
GTCAAGCTCGTCAACATCAGCAGCAGCGACGTCGTCGACGGGAGCCCCAAGCTCATACTG
GGAATGGTGTGGAGTATAATCCTGCACTGGCAGGTTCACTGCCACCTCAAGGAGCTGATG
ACGGACCTTCAGCAGACGAACCTCGAGAAGACGCTCCTGGCGTGGTGCCGCAGTCACACG
CAGAAGTACAGCGGCGTGGAGGTGCGCAACTTCACGTCGTCCTGGTCGGACGGGCT
(296 bp)

- SilkBase 1999-2023 -