SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoMSG_c10964_g1_i1
Scaffold_idBomo_Chr10
NCBI non-redundant
(nr)		phosphatidylinositol_4,5-bisphosphate_3-kinase_catalytic_subunit_delta_isoform_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0000187 P obsolete activation of MAPK activity
GO:0001935 P endothelial cell proliferation
GO:0001952 P regulation of cell-matrix adhesion
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005730 C nucleolus
GO:0005737 C cytoplasm
GO:0005829 C cytosol
GO:0005886 C plasma membrane
GO:0005942 C phosphatidylinositol 3-kinase complex
GO:0006661 P phosphatidylinositol biosynthetic process
GO:0006874 P cellular calcium ion homeostasis
GO:0006897 P endocytosis
GO:0006914 P autophagy
GO:0006935 P chemotaxis
GO:0007155 P cell adhesion
GO:0007156 P homophilic cell adhesion via plasma membrane adhesion molecules
GO:0007165 P signal transduction
GO:0007169 P transmembrane receptor protein tyrosine kinase signaling pathway
GO:0007186 P G protein-coupled receptor signaling pathway
GO:0009611 P response to wounding
GO:0010508 P positive regulation of autophagy
GO:0010628 P positive regulation of gene expression
GO:0014065 P phosphatidylinositol 3-kinase signaling
GO:0014066 P regulation of phosphatidylinositol 3-kinase signaling
GO:0016301 F kinase activity
GO:0016303 F 1-phosphatidylinositol-3-kinase activity
GO:0016310 P phosphorylation
GO:0016477 P cell migration
GO:0016740 F transferase activity
GO:0016773 F phosphotransferase activity, alcohol group as acceptor
GO:0030168 P platelet activation
GO:0035004 F phosphatidylinositol 3-kinase activity
GO:0035005 F 1-phosphatidylinositol-4-phosphate 3-kinase activity
GO:0036092 P phosphatidylinositol-3-phosphate biosynthetic process
GO:0038095 P Fc-epsilon receptor signaling pathway
GO:0038096 P Fc-gamma receptor signaling pathway involved in phagocytosis
GO:0040016 P embryonic cleavage
GO:0043560 F insulin receptor substrate binding
GO:0045171 C intercellular bridge
GO:0046854 P phosphatidylinositol phosphate biosynthetic process
GO:0046934 F phosphatidylinositol-4,5-bisphosphate 3-kinase activity
GO:0048010 P vascular endothelial growth factor receptor signaling pathway
GO:0048015 P phosphatidylinositol-mediated signaling
GO:0050852 P T cell receptor signaling pathway
GO:0050900 P leukocyte migration
GO:0060055 P angiogenesis involved in wound healing
GO:0070527 P platelet aggregation
GO:2000369 P regulation of clathrin-dependent endocytosis
Transcript
Level		FPKM:1.76 TPM:0.92
ORF Entry
Sequence
(Nucleotide)
GTTGAACAACTCCATGAATTTGAGGTCGGAACATCCTCACAACTACGTTCTCAAAGTGTG
CGGCCGTGAGGAGTACCTATTCGGGGATTATCCTTTGATACAGTTTCTATACACACAAGA
GATGCTGGCCGTAGACGGAGTGCCTCAAGTTATGACCGTCAGTATTGATAAATTGCGTTT
ATCCCTGTATCGTGAGATACCATATATGCCGGAACGCAGAAGACTTACATCGGAACATTC
GAACACTATGC
(251 bp)

- SilkBase 1999-2023 -