SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoMSG_c10368_g1_i1
Scaffold_idBomo_Chr1
NCBI non-redundant
(nr)		protein_tyrosine_phosphatase_[Bombyx_mori]
Ontology
GO:0004721 F phosphoprotein phosphatase activity
GO:0004725 F protein tyrosine phosphatase activity
GO:0004726 F non-membrane spanning protein tyrosine phosphatase activity
GO:0005178 F integrin binding
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005654 C nucleoplasm
GO:0005737 C cytoplasm
GO:0005783 C endoplasmic reticulum
GO:0005793 C endoplasmic reticulum-Golgi intermediate compartment
GO:0005886 C plasma membrane
GO:0006470 P protein dephosphorylation
GO:0008285 P negative regulation of cell population proliferation
GO:0008286 P insulin receptor signaling pathway
GO:0010804 P negative regulation of tumor necrosis factor-mediated signaling pathway
GO:0010888 P negative regulation of lipid storage
GO:0016020 C membrane
GO:0016311 P dephosphorylation
GO:0016787 F hydrolase activity
GO:0016791 F phosphatase activity
GO:0019901 F protein kinase binding
GO:0019905 F syntaxin binding
GO:0030183 P B cell differentiation
GO:0030217 P T cell differentiation
GO:0030218 P erythrocyte differentiation
GO:0030971 F receptor tyrosine kinase binding
GO:0035335 P peptidyl-tyrosine dephosphorylation
GO:0042059 P negative regulation of epidermal growth factor receptor signaling pathway
GO:0042512 P negative regulation of tyrosine phosphorylation of STAT protein
GO:0042518 P negative regulation of tyrosine phosphorylation of STAT protein
GO:0042524 P negative regulation of tyrosine phosphorylation of STAT protein
GO:0042527 P negative regulation of tyrosine phosphorylation of STAT protein
GO:0042593 P glucose homeostasis
GO:0045650 P negative regulation of macrophage differentiation
GO:0045722 P positive regulation of gluconeogenesis
GO:0046627 P negative regulation of insulin receptor signaling pathway
GO:0050728 P negative regulation of inflammatory response
GO:0050860 P negative regulation of T cell receptor signaling pathway
GO:0050922 P negative regulation of chemotaxis
GO:0060334 P regulation of interferon-gamma-mediated signaling pathway
GO:0060336 P negative regulation of interferon-gamma-mediated signaling pathway
GO:0060339 P negative regulation of type I interferon-mediated signaling pathway
GO:0061099 P negative regulation of protein tyrosine kinase activity
GO:0070104 P negative regulation of interleukin-6-mediated signaling pathway
GO:0070373 P negative regulation of ERK1 and ERK2 cascade
GO:1902202 P regulation of hepatocyte growth factor receptor signaling pathway
GO:1902206 P negative regulation of interleukin-2-mediated signaling pathway
GO:1902212 P negative regulation of prolactin signaling pathway
GO:1902215 P negative regulation of interleukin-4-mediated signaling pathway
GO:1902227 P negative regulation of macrophage colony-stimulating factor signaling pathway
GO:1902233 P negative regulation of positive thymic T cell selection
GO:1902237 P positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway
GO:1903899 P positive regulation of PERK-mediated unfolded protein response
GO:2000587 P negative regulation of platelet-derived growth factor receptor-beta signaling pathway
Transcript
Level		FPKM:3.41 TPM:1.77
ORF EntryO_BomoMSG2217_5prime_partial:A_BomoMSG_c10368_g1_i1
Sequence
(Nucleotide)
CCGCGATGCTGGCGCTTTGGAGAACGATGTTGGGCCAGCGGTCGTGCATTGCAGCGCCGG
CATCGGTCGCTCTGGAACGTTCTGTCTCGTTGACTCCACTATGGTTATGATACAAAAGGC
CGATGTGAAGTCTATCAACATCGAGCACATTATGCTTGAGATGCGCAAGTATCGCATGGG
TCTAATTCAGACACCTGATCAGCTGCGTTTCTCGTACGAGGCCATCATCGAGGGGGCGAA
GAGGGAGGACCCCAACTACGTACCTTCCAATATGGTCGAGAGCGTGTACTCGCCGGTGAC
TGACGTCGAAGATGATTGTCCTCCTCCGCCTCCTCCGCGCGGTGAGAGCCTCTGTCGCCC
TCCTGCTCGTCCCTTGCCCGCGATTCCTTCAAGCATGTCTCTAGGCGAACTTCACCTGAG
CGCTCCCGTCGAGTCTTCGAGCTCTGACGAATGTCCCCCCACTCCCCCAGAATTAGAACT
ACCGCCCTTCTCTTCAGCCGACGAAGATGAAGAACAGTCCGCCGTCCAGCCCGAGAGCAG
CGAGATCGGAAGAG
(554 bp)

- SilkBase 1999-2023 -