SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoMG_comp12729_c0_seq1
Scaffold_idBomo_Chr10
NCBI non-redundant
(nr)		PREDICTED:_phosphatidylinositol_4,5-bisphosphate_3-kinase_catalytic_subunit_delta_isoform_[Papilio_polytes]
Ontology
GO:0000166 F nucleotide binding
GO:0001779 P natural killer cell differentiation
GO:0001816 P cytokine production
GO:0002250 P adaptive immune response
GO:0002376 P immune system process
GO:0002551 P mast cell chemotaxis
GO:0002679 P respiratory burst involved in defense response
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005737 C cytoplasm
GO:0005829 C cytosol
GO:0005886 C plasma membrane
GO:0005942 C phosphatidylinositol 3-kinase complex
GO:0006468 P protein phosphorylation
GO:0006661 P phosphatidylinositol biosynthetic process
GO:0006935 P chemotaxis
GO:0006954 P inflammatory response
GO:0007165 P signal transduction
GO:0010628 P positive regulation of gene expression
GO:0010818 P T cell chemotaxis
GO:0014065 P phosphatidylinositol 3-kinase signaling
GO:0014066 P regulation of phosphatidylinositol 3-kinase signaling
GO:0016301 F kinase activity
GO:0016303 F 1-phosphatidylinositol-3-kinase activity
GO:0016310 P phosphorylation
GO:0016740 F transferase activity
GO:0016773 F phosphotransferase activity, alcohol group as acceptor
GO:0030101 P natural killer cell activation
GO:0030154 P cell differentiation
GO:0030217 P T cell differentiation
GO:0030335 P positive regulation of cell migration
GO:0030593 P neutrophil chemotaxis
GO:0035004 F phosphatidylinositol 3-kinase activity
GO:0035005 F 1-phosphatidylinositol-4-phosphate 3-kinase activity
GO:0035747 P natural killer cell chemotaxis
GO:0035754 P B cell chemotaxis
GO:0036092 P phosphatidylinositol-3-phosphate biosynthetic process
GO:0042110 P T cell activation
GO:0042113 P B cell activation
GO:0042629 C mast cell granule
GO:0043303 P mast cell degranulation
GO:0045087 P innate immune response
GO:0046854 P phosphatidylinositol phosphate biosynthetic process
GO:0046934 F phosphatidylinositol-4,5-bisphosphate 3-kinase activity
GO:0048015 P phosphatidylinositol-mediated signaling
GO:0050852 P T cell receptor signaling pathway
GO:0050853 P B cell receptor signaling pathway
GO:0060374 P mast cell differentiation
GO:0072672 P neutrophil extravasation
Transcript
Level		FPKM:1.36 TPM:1.08
ORF Entry
Sequence
(Nucleotide)
GAAGGGCTCCGGCGATAACAACGCTATCGACTTCAAAATATTCAAGGAGCATTGCGAAAC
TGCATTCAAAATCCTCCGCAAACATGGACATCTAATACTGTCGTTGTTCTCAATGATGAT
ATCGACGGGGCTGCCGGAACTCAGCTCGGAGAAGGACTTGCAATACCTCAGAGATACATT
AGTAATGGATCGGTCCGAAGAGAAAGCGATGGAGCATTTCCGTGAGAAG
(229 bp)

- SilkBase 1999-2023 -