SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoIG_DN16039_c0_g1_i2
Scaffold_idBomo_Chr12
NCBI non-redundant
(nr)		lactase-phlorizin_hydrolase_[Bombyx_mori]
Ontology
GO:0004553 F hydrolase activity, hydrolyzing O-glycosyl compounds
GO:0004566 F beta-glucuronidase activity
GO:0004871 F obsolete signal transducer activity
GO:0005104 F fibroblast growth factor receptor binding
GO:0005515 F protein binding
GO:0005576 C extracellular region
GO:0005615 C extracellular space
GO:0005886 C plasma membrane
GO:0005887 C integral component of plasma membrane
GO:0005975 P carbohydrate metabolic process
GO:0006112 P energy reserve metabolic process
GO:0007568 P aging
GO:0008152 P metabolic process
GO:0008286 P insulin receptor signaling pathway
GO:0008422 F beta-glucosidase activity
GO:0008543 P fibroblast growth factor receptor signaling pathway
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016324 C apical plasma membrane
GO:0016787 F hydrolase activity
GO:0016798 F hydrolase activity, acting on glycosyl bonds
GO:0017134 F fibroblast growth factor binding
GO:0030501 P positive regulation of bone mineralization
GO:0055074 P calcium ion homeostasis
GO:0070062 C extracellular exosome
GO:0090080 P positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway
GO:1901657 P glycosyl compound metabolic process
Transcript
Level		FPKM:0.11 TPM:0.06
ORF Entry
Sequence
(Nucleotide)
TAAGAATTGGATTACTATAAACGAACCGAAAGAAATTTGCTTCCAAGGTTACGCAATAGG
TACATTAGCTCCAGCATACACTATGAGCGGAGTGGCTGATTACTTGTGTGGGAAAAACGT
TCTTTTAGCTCACGCTAAAGCTTATCATATCTATGACAAAGAATTCCGACCTACCCAAAA
TGGAAATATCTCTATAACCATTAGTTGCCAATGGTATGAGCCTGAAAGCGACCGCGAGG
(239 bp)

- SilkBase 1999-2023 -