SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoIG_DN14301_c0_g1_i1
Scaffold_idBomo_Chr22
NCBI non-redundant
(nr)		DNA-binding_protein_RFX2_[Bombyx_mori]
Ontology
GO:0000790 C chromatin
GO:0000978 F RNA polymerase II cis-regulatory region sequence-specific DNA binding
GO:0003309 P type B pancreatic cell differentiation
GO:0003677 F DNA binding
GO:0003700 F DNA-binding transcription factor activity
GO:0003705 F DNA-binding transcription factor activity, RNA polymerase II-specific
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005667 C transcription regulator complex
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0007275 P multicellular organism development
GO:0007368 P determination of left/right symmetry
GO:0030154 P cell differentiation
GO:0031018 P endocrine pancreas development
GO:0042384 P cilium assembly
GO:0043565 F sequence-specific DNA binding
GO:0044212 F transcription cis-regulatory region binding
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0048469 P cell maturation
GO:0050796 P regulation of insulin secretion
GO:0060285 P cilium-dependent cell motility
GO:0060287 P epithelial cilium movement involved in determination of left/right asymmetry
GO:0072560 P type B pancreatic cell maturation
GO:2000078 P positive regulation of type B pancreatic cell development
Transcript
Level		FPKM:0.29 TPM:0.16
ORF Entry
Sequence
(Nucleotide)
CCAGCCACGCCGCCCACTGCTCCAGCGACGCGCCGCGGCACAGCGTGGCCTTGAAGTCCG
TCTCGAGGCGCAGCGCGTGCGGGGCGGCCGCGCAGGCGCAGGCCCACGCCGCCTGCTCGC
GCACCACGCGGAAGTCCACGCGGTTGAGGTCCAGCACCATCTGGTGGATTTGATGATGAT
TAGTGAGCACGGCTCTGGCGGCCTGCGCTAAGTGGTTGAGTGAGGTGTAGCGCCGCAGGG
CAGCGGCCAGCGCGGCGGCGGCGGCGGCCTGCTCGCGCACCACGCGGAA
(289 bp)

- SilkBase 1999-2023 -