SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10007_c0_seq2
Scaffold_idBomo_Chr4
NCBI non-redundant
(nr)
PREDICTED:_junctophilin-1_isoform_X1_[Bombyx_mori]
Ontology
GO:0005783 C endoplasmic reticulum
GO:0005789 C endoplasmic reticulum membrane
GO:0005886 C plasma membrane
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016529 C sarcoplasmic reticulum
GO:0033017 C sarcoplasmic reticulum membrane
Transcript
Level
FPKM:5.15 TPM:5.64
ORF EntryO_BomoFB11319_complete:A_BomoFB_comp10007_c0_seq2
Sequence
(Nucleotide)
TGTTTCAGAATATACGTATAACAAAATTACGTATCAACAGTCTCATTCGCACGCTTGCCA
TGCCAAATTCGATTAAATAGATAATATATATATAATTCAATATTAAATAACAACATATTT
TTATATATATGTACATATATTAATTTCGCGAAAATTGACTTCTGAGGTAAAAAATAATAG
AAACTTTGTATAAAAACTTGGTACTATATGTCTTCTAGAATAGGAAAATAATGCGCATGC
TTAATTTGCATCTTGCAAGCAATATAATATTATATAGAGTTTTACTTGTAGTTACGTAAA
TTTAATTTACTACTTTACAAAATGAAATAATTGAATATTTTGTTTGTTGAATTTACAAGA
ATCATTGAATATGTTATGCGTATCATTCATTAAATATCATGAGTTTGTGCTCACTTCCAT
CACTTACCGTAATATAAAACTTAATTTTCAAATATGCTACAGTTAACAACGTATGAAACA
CCACTTGGAACAAGACTCTAAAACAATTTTAGAATCCTTGTTGCTTACTTGTATCTGATT
TTGTCTTTGCTTTCTCAACTTAAATTGTATTTTCCAAAGACACTTTAACGTTTTACAAAT
TGGATAACATGAAATTGAACTAAACAACAAAATGAAAACAAAATTGATATAAGTACCTAA
CGTAAAGGGTTTTGTCGAAGGCAACGATAAATAGAGCAACATAATTAATTTGATTTCTCT
TAAATAAAAAATTAACAAATAGCAGTTCAGGATAAAAATGTTAAAATACTTTCTACAGGG
TTTCAGTAATTCAAATGTACACAATGAAATTAACGATAATTTTAACCTACAATTTGTAGG
TCCACGTAACTCTCACAAATCCGTAGTTTCGTCCTGGGGCACATTATTGTTCCATGCACT
CTCTCATAAATCTGCATATTGCCGATACCTTGCAGGATAGGAGTGTAACACTACTTTTAT
TCAATTCAAAACACACTTACACAACGGTAAACAAAAGTCACTGGTAAACAAAATAAGTCC
TAGATGAAAAAAAGGATTCTTTTAATAATTTTGTTCACATTACATAATTATATTAAGATA
TTACATGTTGTGTAACAGTAACGGATTGGAAAAATTGTTTTACAATAACAATTATTTACA
ATAATTAATTTACGGTTTTTTACCCTGAAGGGCAGAAGTGATTTGTGAAGAAATTGACCA
GGCGCCCTAGGGCGCCACCCGCCGACGCTACGTGAGCAGCTTGAAGAACATGATGCCCAG
AGAGATATTGATAAACAGTACAAGGATAACCAGTTGCTGTCGGGAGAACCAGTCCTTGAC
TTGCGGACTGACCAAGTAGAGTAGAGGATTGGCCCTCAGTTTTTCCGATTCCTCGTGCAT
GCGGCGCACTTCCTCGCGTCGCGCGGATCCTAGCGCCGATACCTCTTCGCGGGACATACC
GGTCTCCGCCGCCCGCGGCATACTCGCTACATCGGGGAGAGACTTCTTGCGTTGAAGCGT
CTGCGGCGTGCTCAGCATTTTGCGACCTCCTCCTCCTCCTGCTGCTCGTTGAATGGGTGG
TGGTGGAGTAGGATTTGGTGCTACGTATAAGCTTTCCGTCCTTTTTGGTTGGTACGGAGA
AGGAGATATTTCCTGGCCGAGTGTTCGCTTTCGTAAGAGCGAATCTTCAAATGCGTGATG
CTCTCTAGAACTAGCTCTTGAAATCGAACCACGACCGGACGCTAAATGACCGTTGCCTGC
TGGTGTAGCTGCCCTTGACGGAGGTCGTGATATCGTTTGTGGGGCAATTGAACCACTACG
TGAACTTGGATTCGGTGCGGTAGCATCAACCGAAGGCTGTCGAGATCGTCTGCCGTATCG
ATCCACACTAGAGTCTCGGCTTGGAGGTCTTTTATAGTGATCAAAGTAATCGATTGAAGG
ACGTGTTCCTGGTTGTCGATTATCTCGTGCTCCATTGATAGCGTCCTGTTCAGAGGGATG
TGTTTGACGATAGGCTTGATTGTCGACCGTTCCTTGTCTATATGCTTGATCTGGTTGCGT
TGTCTGTCTATACATATTATTATCTTGGTCATAGTTTTGCCGATAGTTTTGCGGTTCTGT
TGGTCCAGGTTGCTTGTTATCCAGCAAGGCACCTTCAGAGTGTACCGTTCCCGAGCGAAA
TTCGGTGCGCCCGTCAACGTAGGTATTAGCTTGCGTATCATACGTAGGTTGACCGAGAAC
GCTCTGGCGCCTTGTTGCTTGTTGAGGTTGGGGTTGAGCGTTCCAATCCTGTTGTGGTCG
TTGGTTTGCCGTGGCTCTAACTGCTGACGACAATCTCCGACCTTGATTCGTAAATGGTTG
ACCGCTCTGATCATAACTTTGTTGTTGAGATATTGAATCTTGCCTGTTCTGACGATATGG
AGCAGATGGGTTTGGTGGTACACCTGGAGAACCGGTACCATAAGTATTCATTTGTTCATT
TGGTACATACTGTTTGTGTGTGTCCGGAATATATGACTGTGAATTTGTAGGCCATGAATC
TTGTTGAGAGGAATGGTATGGGTCGTGTGGTGGTCCAAGATTTCTGTTATCTGAATTGTA
ATTTGAACTGTTTGCAAGTCGTGGGTCAACTGGTTGATTACCAGTAGTTTTAGGATATTG
CGTAGAAAGTCTTCTGGGCATTGCGTTCGGTACGGCGTTTGTTTGTGGAAGCTGTGAGTG
CGTCGGAGGGATATGATTTGGAATGCTCTTTCCGTCCAAGATCTTTTCAGATTCTTGCGG
TACGGGTGGTGCAACTTGTGCGTCGTAAGCCTTTTGTCTGTATTTTTCTCTTAATCCTAT
TCGGTCGAAACCAGGATGTTTGAAATCTGGTGCGAATTGCTTCGCAGTCATTTGCGCTAT
ATCACAGTCTTCTTTTGCTTGGTCTGCGGCTGCATCCGCTTGTTCGGCTTTACCACGTGC
TGTAGCGGTTCTGGAAATTGCAATGTCCCCTTTTTGCAACGCTATCTTTGAGGCTCGTTG
AGCAGCGTTAACTGCTGAGTCGACACGTTCTCTGAACTTGGCAGAGCGCATCAGGAACAT
GTGTTTGCGTTTTTGGCTCGTGATGAGAACGTTGTTCTTATATTTGCCTTCTTCCTTCGT
GTTATCGCGGAAAGTTGTGACGCCGTATCCGTATTTTCTGTTCTCGAACCATTCACCCTC
GTATCGTAGACCGTCGCTACGTTCACTGATGCCGTAACCAGTACGTTTATCATTTTTCCA
TTCACCCATATATGTTTCTATGATATTGGCATCCAAATGTTCATCCTCAACCATAAAACT
CGTGTTCGAATTAGTGTGCTGAGAGGCATGGGTCATAGCGGAGTGCGTGCTCTCTACGGA
GGACACCCAGGAGGTGGTCGAGTCCCCCGAGCCGGAGCGAACCGAGCCACCGCCGTGCTT
GTCCAAGTCGCCCGCACTGCGCGGCTTGCCGAGCCTAGTAAACAATCCCTTTTTCGTGTT
CTCGAAAAGTGAACCGCGTCTGCCCGAGGGCCGGTCGGAGCGGCGCGCCAACACGAAACC
ACCTCGGGCGTCGTCCATACGGTTGGTTCGCCTTTCCGAAGGATCCGAGGCGCTGCCCAC
TTCCGTGAGCGAAGACATCGAGCCGCGGTGATGGCGCGACGCGGCCCGGTAATGCGACGC
CAGTCCGAAAGGTGCTGATGTACGGACGCCGTATCCATGACGACACCCTCGCATCCATTG
TCCTTGATATGTGCCACCATCGGCGTATGTTTCAGAGCCGTAGCCGTCTTGAAATCCGTT
AGCCCATGTGCCTTCATACTTGGCGTTGCTAATTGTGCTCTGTCGTACGCCGTATCGGCC
TTTGGAACCTTGTGTCCATTCACCGCGATAAATCCACCGGTCGCGGTTTTCGACACCCAA
TCCGTGCCGTTTTCCACTCTGCCATTGTCCTTCGTAAGTGCTCCCACTGGGCCAGGTGTA
GACGCCCGATACTTCAAAACCGAAGTTCCAAGAACCGGCGTAGGCTCCTTGGGCTTTAGG
CCCAGTGCACACTCCGTGGCCATGGGCCTTGCCGTCATCCCAACTACCACAATATGTACC
ACCATCGTCAAAGTCGAATCGGCCACCGTTGAGGCCGCGCTGCGGGGGGTTTCCGCTAGC
AGCGTGCGCGGCATCGGCTAGCTCGCTCGGCTGCATCACGCGAAGCCGTGGTGCCGCGGA
GGGGAGGGCCTCCCGCGCGCACCCTCCACCGAGCTCGCGGTATAAATAAACATCAGCTGG
GCATGTCGCGCCGCGGCGCGCTGCCGAGTGAACACCGC
(4298 bp)

- SilkBase 1999-2022 -