SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10007_c0_seq1
Scaffold_idBomo_Chr4
NCBI non-redundant
(nr)
PREDICTED:_uncharacterized_protein_LOC106720006_isoform_X2_[Papilio_machaon]
Ontology
Transcript
Level
FPKM:1.36 TPM:1.50
ORF EntryO_BomoFB11314_complete:A_BomoFB_comp10007_c0_seq1
Sequence
(Nucleotide)
TGTTTCAGAATATACGTATAACAAAATTACGTATCAACAGTCTCATTCGCACGCTTGCCA
TGCCAAATTCGATTAAATAGATAATATATATATAATTCAATATTAAATAACAACATATTT
TTATATATATGTACATATATTAATTTCGCGAAAATTGACTTCTGAGGTAAAAAATAATAG
AAACTTTGTATAAAAACTTGGTACTATATGTCTTCTAGAATAGGAAAATAATGCGCATGC
TTAATTTGCATCTTGCAAGCAATATAATATTATATAGAGTTTTACTTGTAGTTACGTAAA
TTTAATTTACTACTTTACAAAATGAAATAATTGAATATTTTGTTTGTTGAATTTACAAGA
ATCATTGAATATGTTATGCGTATCATTCATTAAATATCATGAGTTTGTGCTCACTTCCAT
CACTTACCGTAATATAAAACTTAATTTTCAAATATGCTACAGTTAACAACGTATGAAACA
CCACTTGGAACAAGACTCTAAAACAATTTTAGAATCCTTGTTGCTTACTTGTATCTGATT
TTGTCTTTGCTTTCTCAACTTAAATTGTATTTTCCAAAGACACTTTAACGTTTTACAAAT
TGGATAACATGAAATTGAACTAAACAACAAAATGAAAACAAAATTGATATAAGTACCTAA
CGTAAAGGGTTTTGTCGAAGGCAACGATAAATAGAGCAACATAATTAATTTGATTTCTCT
TAAATAAAAAATTAACAAATAGCAGTTCAGGATAAAAATGTTAAAATACTTTCTACAGGG
TTTCAGTAATTCAAATGTACACAATGAAATTAACGATAATTTTAACCTACAATTTGTAGG
TCCACGTAACTCTCACAAATCCGTAGTTTCGTCCTGGGGCACATTATTGTTCCATGCACT
CTCTCATAAATCTGCATATTGCCGATACCTTGCAGGATAGGAGTGTAACACTACTTTTAT
TCAATTCAAAACACACTTACACAACGGTAAACAAAAGTCACTGGTAAACAAAATAAGTCC
TAGATGAAAAAAAGGATTCTTTTAATAATTTTGTTCACATTACATAATTATATTAAGATA
TTACATGTTGTGTAACAGTAACGGATTGGAAAAATTGTTTTACAATAACAATTATTTACA
ATAATTAATTTACGGTTTTTTACCCTGAAGGGCAGAAGTGATTTGTGAAGAAATTGACCA
GGCGCCCTAGGGCGCCACCCGCCGACGCTACGTGAGCAGCTTGAAGAACATGATGCCCAG
AGAGATATTGATAAACAGTACAAGGATAACCAGTTGCTGTCGGGAGAACCAGTCCTTGAC
TTGCGGACTGACCAAGTAGAGTAGAGGATTGGCCCTCAGTTTTTCCGATTCCTCGTGCAT
GCGGCGCACTTCCTCGCGTCGCGCGGATCCTAGCGCCGATACCTCTTCGCGGGACATACC
GGTCTCCGCCGCCCGCGGCATACTCGCTACATCGGGGAGAGACTTCTTGCGTTGAAGCGT
CTGCGGCGTGCTCAGCATCTCAACTGGAGGTACATTTATCCAGCTTTCGGAGGCACGTCG
GGCGAGGATCGCCGGCGAACACATAAGGTCCTCATCTTCGTCTTCTACCTCTTGATACCA
CATCTTTTCTAATATTTCAAACTTATAATTTTCACAAACTTTGTTCGATGTCTTTTGATC
ACATTGCGAATTCGTTCAGGAGCTTACATTTAGTGTTTAGACATCTTATGTACCGCGTAC
TTAATTAGTTGAATATTTATTAAAAAAAATTGTTGTTAGTTTTTTTGTACTTTGTAATGT
ATTCTTTTTTTGGTTTATATATAGCGGGGAGATGGTACGCG
(1841 bp)

- SilkBase 1999-2022 -