SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10006_c0_seq3
Scaffold_idBomo_Scaf198
NCBI non-redundant
(nr)
PREDICTED:_tolloid-like_protein_1_[Bombyx_mori]
Ontology
GO:0004222 F metalloendopeptidase activity
GO:0005509 F calcium ion binding
GO:0005515 F protein binding
GO:0005576 C extracellular region
GO:0006508 P proteolysis
GO:0007275 P multicellular organism development
GO:0008233 F peptidase activity
GO:0008237 F metallopeptidase activity
GO:0008270 F zinc ion binding
GO:0016787 F hydrolase activity
GO:0030154 P cell differentiation
GO:0046872 F metal ion binding
Transcript
Level
FPKM:20.31 TPM:22.25
ORF EntryO_BomoFB11313_complete:A_BomoFB_comp10006_c0_seq3
Sequence
(Nucleotide)
GTGGTACCTACCCGCGCGGACTCGCAAGAGGCCCTACCACCAGTAATAAAGTAATAAAAG
TGTTATTTTACTCCCAAGGGGTTATGCTAGGACATTATCCGGTTAATTTGTGAGCATCTA
ACTTGACCGAATTCAATAAAAACCAAAATATTCCCAAAAAAAAAAGCATTCCAGACAACA
CCGTTAAATCCGTCGCGATTAAGATCGATTGTTGAGGGTGCGATGCGGCCGCCTGTGTCT
CGGGTGGCGGGGTAGCGGCCAGCGTCACGTGGGTCGCCGCACGAACCGCGCCACCGGGGT
CCGGAGCCCCCTGCGCCCCACCACCAGGGGAGGCATGCGCTCGTCCTCCTCCTCAGCCTC
ATATTCTCCGCCTTCCAAGCTGTCTTCGTCGCTCCAAGTCGGTTTTACCATCTGATACGA
TGCCGAAAAGCCTTTGAAGACCAAGGAATCGTCGGTACGGAATCTGACTAGTAAGGCCTC
TGAGGTTGATACGATTTCAGGTGGCATCTTAATACCACAGAACGTTCCATAGTTCCCGCC
GCTTCCTCCCAAACCACCAAACACTTGGACGTAGTCGTATCTGCAGTTCGCTTCCCTCTC
CAGCTCAAAGGTCAGGAAGGTGAGCTTAACGAAGTGATTGCGTGGAGCTTCGATGTTCCA
ATCGCAATCAGCCCGGGACTCGTAGGCGTTGTCTCCGTAGCGCGCGTGAGAATAGAGATG
CTTCACCTCTTCCGTCGCAGAGAGATACCCTCCACATGCAGTAGAATGCGTAGCCAAGAA
TCCCTTTCTCTGCACAGAGCCGTCACTCTTGAATACCATGTACATCTGGTTCTGAGATGC
CATGACCAGATGCGGGAGCTTACTGCCGCAGAATATGCCGAGCGTTTTTACGTCGGCCGA
AGCTCCGTCGTAGATCGTGACGTGGTCGTAAGCGCATTCTTGGTGAGGCTCTAATTCGAA
GACGTTGAAGATCAGTTTAATTCGATGACCGGGTGTCGTAGAGAATTGCCAAACGCAATC
TTTCCTTGCTGGGTACGCGGCCGGATAATTCGGACTGAAAATAGTTCCGTGGGGTAATGT
AACGTCATGCTTGCATCCGCCTTCCTTGCAGTCGTGCTTGTTCGGATGTAAAGTGAAGCC
GCTGTGACAGGCGCACTCGTATCCTCCCAGCGTGTTGTGGCACTCGTGCTGACATCCCCC
GTTGTTCTCGGCGCATTCGTCCACGTCTATGTAGTACACTGCCGCGAAACCGGACCGGTG
GACCGAGCCGTCTGATGTGAACTGAACTCTCAAAACCGATCCATCCGAAGTGACCGGTGG
TGGTAAGGCGGTCCCACAAAACGCTCCGTGCCTCCTGAGCACATCAGCTCCTAGCTTCGA
ATGTACTGTTACACTATCATATTCACATTCCTGTTGATACATATGGTTCCCTTCTAAGTC
GAAATGTGTGAAGTTCAGCGTAATGCGATGCTGGGGCGGCGCCACGATCTCCCAGAGGCA
GTTCTTCAACGGAGGATACAGTTCGGGGAAGGAAGGTGATGTGATCGTACCGTTGGGGCC
GTAGAGTGCTCCTCCGCATGCGTTTTCACATTTCTTTCCGTCCGAATGGAGTTCATATCC
GATGTCGCACGCGCACTCGTATCCACCGAGGGTGTTCACGCAGGAGTGGCTGCAGCCGTG
ATCGATGGAAGCGCATTCGTCGAATTCCTTCATGAACGTGGCTGAAAAACCAGCTTTCTG
GACTGTGCTGTCCGACTCGAAAATCACCAGAAGCTTGTTCGATGTGGACCTTATATCGGG
AGGTATCTTATGTCCACAGAACATGCCGATAAGTGGACTGTCCATTGAATCGCCGTCTCT
GACCTTGACTTTGTCGTAGGAGCATGTATCGTGGTTTTCCACTTCGAACGAATGGAACCT
CAAAGCAACTTGGTAGTCCTGTGGTACTGATAGTTTCCAGATACATAGTTTGTTAGGCTG
GTAATCGTCAGGATAGTTCGGCGATTCGAGGTGTCCATTCGAATCCACTTCTATATCACC
TCCGCAAACGGCTTCGTAGAATGCTCGGAATCCTCTATGCGGCTTAAGCCTCAAGCCCGG
TTGATAGACCACAGTGAGTCTTGATCCAGTAGACCTCATCATAGGACCCTTTCCGGACCC
GCACAACCTGCCCAAAACTGGAGCGTCGGGCATATAGCCGTCTCGTATTTCAACCCACTC
CGAACGGCAGTCTTCAGACTTGTGAATGTCAATTTCAGTGATATTGAGCACGACCCTTTC
TCCGTGAGTAGCCACGATCCTCCACTCGCAACGTTCTGGTGTTGTGGGCGCTGGCTCGGT
TCCCCAGCCAGGCGAGTTGAACCACCCAGAGTTGCCCAATAATGTCCTGCCGCATTTGGC
ACATTTATATAATAGATTAGTCTGCGCTATGTCACTGGCGCTAAGTTTGATTCTCTGCCC
GATCTCTGGTCGTTTCTTTCCGTGCACCTCCAACGGCAAGATAGTGTCCAAAAATGATCC
TTTACTGAACGTGTTTCGTGCGTAATGCATTATTGAATCATAATCGTACGTTTGTCCTAG
TGAATTTACTTCTTCAACTGTTAGCTTGTTGAAATTGTATTCTTGGCCGAGCATGATGTT
GTCCCGTATGATCTGCACGTGGTTATCCCTGTCGGGCCTCGTATGCTCGTGCCAGAAGCC
GACAACGTGGCCCAGCTCGTGAACCACGATGCCGAATTTGTCGCAGTTCTTCCCAATTGA
TATAGCCTGGGCGCCTGCGCCCCTTTTGCCGACGAATGAGCAGCAGCCACAAGGCCGTTC
CGTGAACACAATGTAATCCTTATGCACTTCTGGATCCCTTTCGACAAATTTGACGCAAGT
AAAATTCTCCCAATGCCTCATAGCTTGCTTGAATAATGACTTGTGGGCGCCACTGAAGTT
TCCATCTATCTCGTAAGGAATGACACCGTTGTCCCAGATACGTTCCTTACGGTTTGTGGC
GGCCCGGATCGTGCGGTGTCGCTTTTTAGGCCCGGTGGAATTGTACTGGTTACTTTCGGC
CATCATTAAATCTTCTTCGGTGTCCCGAAAGACCATGTCTTTAAACGGATCGAATTCCGT
TAGATTTTTCGGCGGCGGTTTCACTTCGAACTTATCTTCAAATTCGTGTTCCGGTACTTC
GAGTTTCCTTTCCGAGCTCCTGTACTCTTTGCTGCCGCTGTGCCTCTTGTGGTGACGAAA
AAACTTCTTTCTCGCGAAATGGTCGTCTAAGGAGCGTCCTTCGCTTAGTGAATTCGGTGA
AATCCTTTCGCCCGAACTTATGTTTCTTAGTCTTCTTCGATTGCCGTGTCTGCGTCTTCT
TCGATTCCTTCTTCCTGGATTCTCGAGAGTCAAATTTTGCAAGCTTTCTGTGGGTTTCAA
TAAATCAATATTCTTAACTTTTAATTCCCGTTCAGTTTTATTGATTTCCTTTTCGTCGTC
TTGGTCGCTGTTCGATAAAAAACCATTTGTGGGAGCAGGAGCCATCGTCACGTTCTCTGG
TATGTCTTTGAACTGTATATTGTTTGAATCTCCTGTTATTTCTCGGCTGTTGCTCTGGAT
TTTATTTGTCTTTTCGTCCTGTTTCCTTGAGGCATTTGATATTTGAATAAAAGGATACAG
TTCGTCCAAATTGAGGATGTTGTCAGTAGATATGTTTACAACCAGTACGCCGTCTTGCTC
TAGGCTCTCAGATTCGGAAATGTTCTCTACGCTGGACCTGTTTGCAATGTGCACATCGGA
TTTGGTTTCGTTAAATTCTGTACTGTTATCTAGGATTTCTTCTGGAAGTAGCTTGCCGTT
TTTGAGCACAAGCGACTTGTCTACTCCTTCTGGTAGTGACTCACTCATAAGTGCCGCGTC
ATTGTAACCCTTCTTGTCTTGAGATAGTTGGACGGGCTGTTTTGTCCTTTTCCTTAATAT
ATCCGGAAGACCTTCCTCCTCGACCTGTAGACCTTCGAGCAGAACCTCCTTCTTCAGTCG
TTCAACTTCTTCTTGGAAGGACTTGTCGATCTTGACCGGAGGGCTAGTCGCCGTTTTATA
AAGATCTGAATCCGGGATCGCAATGTCACCTTGGAAGTTTCCGGCTTTACAAGGGTCCAT
TCCGATGTCTCCTGATTCTTTGTATTCAAAATGCGCAGACAATAACTCGTCCACGGTAAA
TTTGTGCGGTTCGTTCCTCCCCTCCACCGAGGCTACTTGTAGCGTTGCGTAAACAATTAA
AGCCATAACAACGGCAGCCGTCGCCGGCACTACACGTATACAATTTGCAGTCATATTTAA
GTAGTTTATATTTTACTATACTACGAACACTTTAACATTGTGCGAAGCTCGGAGAGTTTA
TCTAATTTTATATTTATTTGGAAGGCACCCCGATAAAAACAGTGATTTTTTATTAAAAAC
AACACGAATATGCAGTTTTGTGACGTATAAAAATAAGTGACACGGTCAGTTACGAT
(4496 bp)

- SilkBase 1999-2022 -