SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10006_c0_seq1
Scaffold_idBomo_Chr9
NCBI non-redundant
(nr)
PREDICTED:_tolloid-like_protein_1_[Bombyx_mori]
Ontology
Transcript
Level
FPKM:0.30 TPM:0.33
ORF EntryO_BomoFB11310_complete:A_BomoFB_comp10006_c0_seq1
Sequence
(Nucleotide)
TCATTCATTCATTCATTCATTATTGATGTTAGTATAATCACCCCGGTGGAATTGTACTGG
TTACTTTCGGCCATCATTAAATCTTCTTCGGTGTCCCGAAAGACCATGTCTTTAAACGGA
TCGAATTCCGTTAGATTTTTCGGCGGCGGTTTCACTTCGAACTTATCTTCAAATTCGTGT
TCCGGTACTTCGAGTTTCCTTTCCGAGCTCCTGTACTCTTTGCTGCCGCTGTGCCTCTTG
TGGTGACGAAAAAACTTCTTTCTCGCGAAATGGTCGTCTAAGGAGCGTCCTTCGCTTAGT
GAATTCGGTGAAATCCTTTCGCCCGAACTTATGTTTCTTAGTCTTCTTCGATTGCCGTGT
CTGCGTCTTCTTCGATTCCTTCTTCCTGGATTCTCGAGAGTCAAATTTTGCAAGCTTTCT
GTGGGTTTCAATAAATCAATATTCTTAACTTTTAATTCCCGTTCAGTTTTATTGATTTCC
TTTTCGTCGTCTTGGTCGCTGTTCGATAAAAAACCATTTGTGGGAGCAGGAGCCATCGTC
ACGTTCTCTGGTATGTCTTTGAACTGTATATTGTTTGAATCTCCTGTTATTTCTCGGCTG
TTGCTCTGGATTTTATTTGTCTTTTCGTCCTGTTTCCTTGAGGCATTTGATATTTGAATA
AAAGGATACAGTTCGTCCAAATTGAGGATGTTGTCAGTAGATATGTTTACAACCAGTACG
CCGTCTTGCTCTAGGCTCTCAGATTCGGAAATGTTCTCTACGCTGGACCTGTTTGCAATG
TGCACATCGGATTTGGTTTCGTTAAATTCTGTACTGTTATCTAGGATTTCTTCTGGAAGT
AGCTTGCCGTTTTTGAGCACAAGCGACTTGTCTACTCCTTCTGGTAGTGACTCACTCATA
AGTGCCGCGTCATTGTAACCCTTCTTGTCTTGAGATAGTTGGACGGGCTGTTTTGTCCTT
TTCCTTAATATATCCGGAAGACCTTCCTCCTCGACCTGTAGACCTTCGAGCAGAACCTCC
TTCTTCAGTCGTTCAACTTCTTCTTGGAAGGACTTGTCGATCTTGACCGGAGGGCTAGTC
GCCGTTTTATAAAGATCTGAATCCGGGATCGCAATGTCACCTTGGAAGTTTCCGGCTTTA
CAAGGGTCCATTCCGATGTCTCCTGATTCTTTGTATTCAAAATGCGCAGACAATAACTCG
TCCACGGTAAATTTGTGCGGTTCGTTCCTCCCCTCCACCGAGGCTACTTGTAGCGTTGCG
TAAACAATTAAAGCCATAACAACGGCAGCCGTCGCCGGCACTACACGTATACAATTTGCA
GTCATATTTAAGTAGTTTATATTTTACTATACTACGAACACTTTAACATTGTGCGAAGCT
CGGAGAGTTTATCTAATTTTATATTTATTTGGAAGGCACCCCGATAAAAACAGTGATTTT
TTATTAAAAACAACACGAATATGCAGTTTTGTGACGTATAAAAATAAGTGACACGGTCAG
TTACGAT
(1507 bp)

- SilkBase 1999-2022 -