SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10005_c0_seq5
Scaffold_idBomo_Chr10
NCBI non-redundant
(nr)
PREDICTED:_serine/threonine-protein_kinase_tousled-like_2_isoform_X5_[Bombyx_mori]
Ontology
Transcript
Level
FPKM:0.94 TPM:1.03
ORF Entry
Sequence
(Nucleotide)
GAGGTGTCAGTGATAGTGGATTTTCGTAATTGCGTGCTGATGACACACGTAGTGAATGTG
GATGGAGTACAAAATTGTTTTGGAAGATGCATTTCAAAGAGGCGTTCGCGATGAGCGATC
GACCAAGCGAACGCGGCCGCCGCAATTCTCGGTGCAAGGGTGCTGGCGTCAAGATGGAGC
ACTTCCAGGCGGCGCTGGATCCTCGCAAGCAGGAGCTTCTCGAAGCACGATTCTTAGGAG
CCAAAATGTCAGCTGGTTCACAAATTCAGATGGCACCACAAACTACTGTCAACACGGGGC
AACCGCTACACAGTCAGGACTCCAATATGAGCACAG
(336 bp)

- SilkBase 1999-2022 -