SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10005_c0_seq4
Scaffold_idBomo_Chr10
NCBI non-redundant
(nr)
PREDICTED:_serine/threonine-protein_kinase_tousled-like_2_isoform_X4_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0001672 P regulation of chromatin assembly or disassembly
GO:0004672 F protein kinase activity
GO:0004674 F protein serine/threonine kinase activity
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005856 C cytoskeleton
GO:0005882 C intermediate filament
GO:0006468 P protein phosphorylation
GO:0006974 P cellular response to DNA damage stimulus
GO:0007049 P cell cycle
GO:0007059 P chromosome segregation
GO:0007275 P multicellular organism development
GO:0007283 P spermatogenesis
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016568 P chromatin organization
GO:0016740 F transferase activity
GO:0018105 P peptidyl-serine phosphorylation
GO:0030054 C cell junction
GO:0030154 P cell differentiation
GO:0032435 P negative regulation of proteasomal ubiquitin-dependent protein catabolic process
GO:0035556 P intracellular signal transduction
GO:0048471 C perinuclear region of cytoplasm
GO:0071480 P cellular response to gamma radiation
Transcript
Level
FPKM:3.27 TPM:3.58
ORF EntryO_BomoFB11308_3prime_partial:A_BomoFB_comp10005_c0_seq4
Sequence
(Nucleotide)
GTTGTGATATTTGGTGAATAGTAGTTTTTGTAGTAGAGGCCTACAATTTTGTAGTTTAAA
GAAAATTCGTGGGAAATAGGAAAACACTGACAATTTAAATATATTTCGTCGCCATTTTCG
TACTCTGCTGATGAAAAACTAAAAAAAATTGTGATACATTCAAGTGAAGTGATATGTGAT
TTTATCTTAAAATTTGACCACAAATGGGACTGTTCTTAAGGAGAAATTTCATCCATATTT
TGACTGTACCATGACAAGTTTCTTCAATTTGATGTCCGAGGTATCATCGAAACAGAAATT
ATTAGGCCCATAACTCATAGGCATGACGGAAAAGGTGTTGCACCTGGGTGCTGGCGTCAA
GATGGAGCACTTCCAGGCGGCGCTGGATCCTCGCAAGCAGGAGCTTCTCGAAGCACGATT
CTTAGGAGCCAAAGTCACAGCAAGGGAGATAATAGTAGAAACTCATCGTGCTCCAGAATT
CAAAATGATGTCAGCTGGTTCACAAATTCAGATGGCACCACAAACTACTGTCAACACGGG
GCAACCGCTACACAGTCAGGACTCCAATATGAGCACAGGGTCATCTCATAGTGATAAAGA
AGTTGATGCTTTAACTCCGGAGAAGTCTGTAGCTATGCGAGGCTCAACTGCTGCGTCAGG
CACAGTCCTGGTTGCTCCTGGTGGTGCCACACCTACCATAACAATGCCGGAGAGGAAGCG
AAAACGAAAAGGAGATGAAGGAGTTGGTGGTGGTGGGGGTGGAGGAGGAAAGCAACGCCA
TAACTCGTCAGATAAAAATATACGAGAATATTTCTCAAAGCACCCCTCGTCCAGTCCTGT
AAGGCATGCTGGAGCTAAATCCCCCTCGCCTCAAGGCGCCAATTATCCTATGTACCCACC
GTCACCTTCATCACTATTGCCAGGAGCTGACTTCATGCGAGCAGCTTCTCAACAAAGACC
TCACACATCAGTTAAACAGATTCAGACAGAAATGACATGTCAGAGGATACAAGAGTTAGA
AACTCAGGCATCTTCTGATTTAGAACTAAGAAATAATAAAATAGATGAATTAACACGGAC
AAATGAAGAGCTAAAGCATCAAGTGCAAGCTCAAAATAAGGTGATTGAACAACACAAATC
ACACATCAACAAATGTATAGAAGTAGTTAAGAAATTGTTGAATGAAAAAAGTACTATTGA
AAAGAAGGAAGCCCGACAGCGCTGCATGCAAAATAGACTGAGGCTAGGCCAGTTTGTCAC
GCAACGCGTCGGTGCCACCTTTCAAGAAAATTGGACTGATGGATATGCATTTCAAGAGCT
AACAAGGCGACAAGAAGAGATTACAGCGGAGAAAGAGGAGATAGATCGGCAGAAGAAACT
GTTGTTCAAAAAGCGTCCAGTGAACACAGAGGGCGGAGGGGGACGCGGCAAGCGAACAGC
CAGCGCCGCCCCTTCCACGCCCCAACCTTCGCCGTTACATAACGGCACTGACGCACCCAC
CTTCCTCAAGCCAGACCCACTACCCAGCATGACCTACCAAGAGTACTATGAGGCTGATGA
AATTCTTAAGTTAAGGCAGAGTGCACTAAAAAAAGAAGATGCAGATTTACAGCTAGAAAT
GGAAAAGTTAGAAAGAGAAAGGAACCTTCATATTAGGGAATTGAAACGAATACACAATGA
AGACCAGAGCCGTTTCTCACAGCATCCTGTGCTCTCTGAACGGTATTTACTGCTGATGCT
GCTCGGCAAGGGTGGATTCAGTGAAGTACACAAAGCGTTCGATCTAAAGGAGCAACGATA
CACCGCGTGTAAAGTGCATCAGCTCAACAAAGACTGGAAGGAAGACAAGAAAGCCAATTA
TATCAAACACGCACTACGGGAGTACAACATCCATAAAGCCCTGGATCACCCTCGCATCGT
AAAACTGTACGATGTATTCGAAATCGACGGAAATTCGTTTTGTACAGTACTTGAATACTG
TAATGGACATGATCTCGACTTTTATCTCAAACAGCACAAAACAATCCCGGAGCGTGAAGC
GCGTTCCATTGTGATGCAAGTGGTGTCAGCATTAAAGTATCTGAACGAAATAAAACCACC
TGTCATTCACTATGATCTGAAACCCGGGAATATTCTACTAACGGAAGGCAATGTTTGTGG
CGAGATCAAAATTACAGACTTTGGCCTCTCCAAAGTAATGGACGAGGAGAACTACAATCC
TGACCATGGCATGGACTTGACCAGCCAGGGAGCCGGTACATACTGGTATCTGCCACCGGA
ATGTTTCGTCGTTGGAAAAAACCCACCAAAGATAAGTAGTAAGGTGGATGTTTGGAGTGT
GGGTGTTATCTTCTACCAGTGCCTGTATGGAAAGAAGCCGTTTGGCCACAACCAGAGCCA
GGCCACTATATTGGAAGAAAACACCATACTAAAGGCAACTGATGTTCAGTTTGCTAACAA
ACCCACAGTCAGCAATGAGGCTAAAAGTTTCATCCGCGCGTGCCTGGCGTACCGCAAAGA
GGAGCGCATCGATGTGTTCGGTCTGGCGCGGCACGAATACCTGCAGCCGCCGACGCCCAA
GTCTCGCGGTGCGGGGGCGGG
(2601 bp)

- SilkBase 1999-2022 -