SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10005_c0_seq3
Scaffold_idBomo_Chr10
NCBI non-redundant
(nr)
PREDICTED:_serine/threonine-protein_kinase_tousled-like_2_isoform_X11_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0001672 P regulation of chromatin assembly or disassembly
GO:0004672 F protein kinase activity
GO:0004674 F protein serine/threonine kinase activity
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0006468 P protein phosphorylation
GO:0006886 P intracellular protein transport
GO:0006974 P cellular response to DNA damage stimulus
GO:0007049 P cell cycle
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016568 P chromatin organization
GO:0016740 F transferase activity
GO:0035556 P intracellular signal transduction
Transcript
Level
FPKM:1.80 TPM:1.97
ORF EntryO_BomoFB11307_3prime_partial:A_BomoFB_comp10005_c0_seq3
Sequence
(Nucleotide)
ATGTCAGCTGGTTCACAAATTCAGATGGCACCACAAACTACTGTCAACACGGGGCAACCG
CTACACAGTCAGGACTCCAATATGAGCACAGGTAATTTGTGGTGGTGTTGAGTGCTGTAA
ACATTGGTGATGTGTTCAGTGATCAGTGTTGACTTGGAGCCGGTTAAATGAACGTAAACA
GACTAGAAACTTGTGATCAGTGGAGTTTGTGTAATAAATCTTAAGGCAAGGGATTGTGAC
GTACTATACTCGTAAACGATGCCGGATAGGTACCGTGAAAGTGTTAATTTATTTCCCGAA
ATACAAGACTTCTGTGCCCTTCTGATAAAATGCACGAGTATAATTCCGGAGCTAACATAA
ACCACGTCAGCCTTCTGAATACCTTGTCTAAAAGGTCATCTCATAGTGATAAAGAAGTTG
ATGCTTTAACTCCGGAGAAGTCTGTAGCTATGCGAGGCTCAACTGCTGCGTCAGGCACAG
TCCTGGTTGCTCCTGGTGGTGCCACACCTACCATAACAATGCCGGAGAGGAAGCGAAAAC
GAAAAGGAGATGAAGGAGTTGGTGGTGGTGGGGGTGGAGGAGGAAAGCAACGCCATAACT
CGTCAGATAAAAATATACGAGAATATTTCTCAAAGCACCCCTCGTCCAGTCCTGTAAGGC
ATGCTGGAGCTAAATCCCCCTCGCCTCAAGGCGCCAATTATCCTATGTACCCACCGTCAC
CTTCATCACTATTGCCAGGAGCTGACTTCATGCGAGCAGCTTCTCAACAAAGACCTCACA
CATCAGTTAAACAGATTCAGACAGAAATGACATGTCAGAGGATACAAGAGTTAGAAACTC
AGGCATCTTCTGATTTAGAACTAAGAAATAATAAAATAGATGAATTAACACGGACAAATG
AAGAGCTAAAGCATCAAGTGCAAGCTCAAAATAAGGTGATTGAACAACACAAATCACACA
TCAACAAATGTATAGAAGTAGTTAAGAAATTGTTGAATGAAAAAAGTACTATTGAAAAGA
AGGAAGCCCGACAGCGCTGCATGCAAAATAGACTGAGGCTAGGCCAGTTTGTCACGCAAC
GCGTCGGTGCCACCTTTCAAGAAAATTGGACTGATGGATATGCATTTCAAGAGCTAACAA
GGCGACAAGAAGAGATTACAGCGGAGAAAGAGGAGATAGATCGGCAGAAGAAACTGTTGT
TCAAAAAGCGTCCAGTGAACACAGAGGGCGGAGGGGGACGCGGCAAGCGAACAGCCAGCG
CCGCCCCTTCCACGCCCCAACCTTCGCCGTTACATAACGGCACTGACGCACCCACCTTCC
TCAAGCCAGACCCACTACCCAGCATGACCTACCAAGAGTACTATGAGGCTGATGAAATTC
TTAAGTTAAGGCAGAGTGCACTAAAAAAAGAAGATGCAGATTTACAGCTAGAAATGGAAA
AGTTAGAAAGAGAAAGGAACCTTCATATTAGGGAATTGAAACGAATACACAATGAAGACC
AGAGCCGTTTCTCACAGCATCCTGTGCTCTCTGAACGGTATTTACTGCTGATGCTGCTCG
GCAAGGGTGGATTCAGTGAAGTACACAAAGCGTTCGATCTAAAGGAGCAACGATACACCG
CGTGTAAAGTGCATCAGCTCAACAAAGACTGGAAGGAAGACAAGAAAGCCAATTATATCA
AACACGCACTACGGGAGTACAACATCCATAAAGCCCTGGATCACCCTCGCATCGTAAAAC
TGTACGATGTATTCGAAATCGACGGAAATTCGTTTTGTACAGTACTTGAATACTGTAATG
GACATGATCTCGACTTTTATCTCAAACAGCACAAAACAATCCCGGAGCGTGAAGCGCGTT
CCATTGTGATGCAAGTGGTGTCAGCATTAAAGTATCTGAACGAAATAAAACCACCTGTCA
TTCACTATGATCTGAAACCCGGGAATATTCTACTAACGGAAGGCAATGTTTGTGGCGAGA
TCAAAATTACAGACTTTGGCCTCTCCAAAGTAATGGACGAGGAGAACTACAATCCTGACC
ATGGCATGGACTTGACCAGCCAGGGAGCCGGTACATACTGGTATCTGCCACCGGAATGTT
TCGTCGTTGGAAAAAACCCACCAAAGATAAGTAGTAAGGTGGATGTTTGGAGTGTGGGTG
TTATCTTCTACCAGTGCCTGTATGGAAAGAAGCCGTTTGGCCACAACCAGAGCCAGGCCA
CTATATTGGAAGAAAACACCATACTAAAGGCAACTGATGTTCAGTTTGCTAACAAACCCA
CAGTCAGCAATGAGGCTAAAAGTTTCATCCGCGCGTGCCTGGCGTACCGCAAAGAGGAGC
GCATCGATGTGTTCGGTCTGGCGCGGCACGAATACCTGCAGCCGCCGACGCCCAAGTCTC
GCGGTGCGGGGGCGGG
(2416 bp)

- SilkBase 1999-2022 -