SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp1000502_c0_seq1
Scaffold_idBomo_Chr9
NCBI non-redundant
(nr)
hypothetical_protein_XE03_1666_[candidate_division_TA06_bacterium_34_109]
Ontology
Transcript
Level
FPKM:1.03 TPM:1.13
ORF Entry
Sequence
(Nucleotide)
CTGAGAAAATCCGGTGAGAAACTCCGTAGGCTGTGTTTATGCGTTAGTTCGCTAACTCTT
CGACAAGTTCGACGAGAACGGTAACCGGTACTCGAGCTTCGACTCGTAAAAGCACAGAGT
GGGGCCGGAGGATGCGACATCGGGGGACAAGGCATGTTTCCCGCGACTGCGGATTGGCTT
AGCCCCGTCGCCTATATCGGTTATGTAATTAGCAGGGGCCACGATAAGG
(229 bp)

- SilkBase 1999-2022 -