SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10004_c0_seq1
Scaffold_idBomo_Chr13
NCBI non-redundant
(nr)
LOW_QUALITY_PROTEIN:_hypothetical_protein_M514_20815_[Trichuris_suis]
Ontology
Transcript
Level
FPKM:1.82 TPM:1.99
ORF EntryO_BomoFB11304_3prime_partial:A_BomoFB_comp10004_c0_seq1
Sequence
(Nucleotide)
GACAAGAGACTGGGGCGCCCTCAGTGGTAAGAATATAATGAACTGTGTTATGCTTCGGCT
CACGAATAAGTCCTGGTGGCTTCGTAATGGACGGAAATTCCGCAAGAAGTGCACTAAATT
GGGATGACGGAGCGCAGACAACTTTGACGCTGGTCTGGTCTAAAACAGAGACGGCAGCAA
CGCATGACAACCCGGTAATGCTATCGACGAGTCTCTTACTGGCACAATCTGGCAACAACC
GATAGTGCGCCAGAAAATCGGAGCCGATGATGGCGGTGTTGACGTCAGCGATAATAAATC
GCCATTGAAATGTGCGGCGTAGCCCCAAATTAAGCGCCATTTCTATGTGACCAAAAGTGC
GTATCTCACTACCATTGGCAGCCGCTAATGTATAATTTGAACGTATCGGCTTATTTGATA
ACCACTGATATGGATAACAGGAGAGGTCAGAGCCTGTGTCTATTAAAAAACGGCGCTTGG
TTGAGCTTTCGGTGACAAATAATCGGCGACTCTCCTTTAAGCAGTCAGACGTCGCCATCA
TTGACTGCTTTTGTCGTTTTCCGAAGGTGGCGGCGGCGTCCAGGTACATGGTTGAATACA
CTTAACAGCTTTAGTATTAAATTTCCTATGGTAAAAGCACATTTGAGGCTTACCAGGTGT
TTGTGAGCGTCGTCGCTGATTTGAGAAATCCCGGGTCCTATTTCTACCGCGCTCTGCAGT
AAGCACAGCAAGCTGACGCGTGACCTCATCCAGACGCCGTGTGATATCTTCTAACGAAGG
GGGTGAGACGGCAGACGTGCTTGCTGAGAAAACAGCAGATGAATGAGGTGCGAACATACC
AGGCGAAACTTCCAAAATTTTGTCCGCTAGCTCAGCGACTTTGTCCAGCGAGAGTTCTGA
TTGGGCGGCCAAAATTGCTTGGAGATGTTGTGGGAGGCGACGCATCCATAGCTGGCGGAG
CAGATTTTCATCAGTGAGGGTGTTTCCTGCCAATGATCTAAGATGACGTAAAAACTGCGA
AGGACGGCGGTCACCCAATTCAACATCACTGACAAGTTGCCGGACACGTTGCTCCTCAGA
CGTGGACAACCTACGGATCAACTCGGATTTGAGGCGACCATATTTGTCCTCAGGTGGTGG
TTGGAGAATAATGTCCTCTACCTCCCCAATAACTCGGGTATCTAACTGAGCAATCACGTA
GTTAAATTTAGCCAGGTCAGCGGAGATGCCTGAAATCGAGAACTGTGCCTCTACCTGAGC
AAACCAAATTGCAGGTTGATCAGGCCAGAAGGGAGGAAGTTTTATGGCTACTCTGCATAC
TGAGGTAGGTTGAGGAAATAATGGGTCTGTGGGGGGTGGGTCCGTTTTATCGATGCCTTG
CATTTTAAGTTTTTGTAATTCAGCCTTTAGGATGGCATTTTGTTGTTGTAACAGCGTATT
TTCTTCTCTTACTAATTGTTCGTTTGCCTTCATTATTGAACATTACGTTTACAATTG
(1497 bp)

- SilkBase 1999-2022 -